ID: 1082657055

View in Genome Browser
Species Human (GRCh38)
Location 11:55869002-55869024
Sequence CTGAGCAAAGAGAAGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082657047_1082657055 -10 Left 1082657047 11:55868989-55869011 CCTGGTCTCCCTTCTGAGCAAAG No data
Right 1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082657055 Original CRISPR CTGAGCAAAGAGAAGGGGGT GGG Intergenic
No off target data available for this crispr