ID: 1082659636

View in Genome Browser
Species Human (GRCh38)
Location 11:55894638-55894660
Sequence TAGGGTGTACGTGGGTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082659629_1082659636 12 Left 1082659629 11:55894603-55894625 CCAGGGAACTCCAAGGCTACTGA No data
Right 1082659636 11:55894638-55894660 TAGGGTGTACGTGGGTACAGTGG No data
1082659625_1082659636 30 Left 1082659625 11:55894585-55894607 CCATTGCATAAATGAGGTCCAGG No data
Right 1082659636 11:55894638-55894660 TAGGGTGTACGTGGGTACAGTGG No data
1082659631_1082659636 2 Left 1082659631 11:55894613-55894635 CCAAGGCTACTGACAGCAGGAGA No data
Right 1082659636 11:55894638-55894660 TAGGGTGTACGTGGGTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082659636 Original CRISPR TAGGGTGTACGTGGGTACAG TGG Intergenic
No off target data available for this crispr