ID: 1082659636 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:55894638-55894660 |
| Sequence | TAGGGTGTACGTGGGTACAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1082659629_1082659636 | 12 | Left | 1082659629 | 11:55894603-55894625 | CCAGGGAACTCCAAGGCTACTGA | No data | ||
| Right | 1082659636 | 11:55894638-55894660 | TAGGGTGTACGTGGGTACAGTGG | No data | ||||
| 1082659625_1082659636 | 30 | Left | 1082659625 | 11:55894585-55894607 | CCATTGCATAAATGAGGTCCAGG | No data | ||
| Right | 1082659636 | 11:55894638-55894660 | TAGGGTGTACGTGGGTACAGTGG | No data | ||||
| 1082659631_1082659636 | 2 | Left | 1082659631 | 11:55894613-55894635 | CCAAGGCTACTGACAGCAGGAGA | No data | ||
| Right | 1082659636 | 11:55894638-55894660 | TAGGGTGTACGTGGGTACAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1082659636 | Original CRISPR | TAGGGTGTACGTGGGTACAG TGG | Intergenic | ||
| No off target data available for this crispr | |||||