ID: 1082663803

View in Genome Browser
Species Human (GRCh38)
Location 11:55949197-55949219
Sequence GGTTTGTGAGTGTGCAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082663803_1082663808 29 Left 1082663803 11:55949197-55949219 CCTCTTTTGCACACTCACAAACC No data
Right 1082663808 11:55949249-55949271 ATAAAGACCCCAGAGTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082663803 Original CRISPR GGTTTGTGAGTGTGCAAAAG AGG (reversed) Intergenic
No off target data available for this crispr