ID: 1082671701

View in Genome Browser
Species Human (GRCh38)
Location 11:56043052-56043074
Sequence GATAGCTCTTTGCCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082671697_1082671701 16 Left 1082671697 11:56043013-56043035 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1082671701 11:56043052-56043074 GATAGCTCTTTGCCTGCTACTGG No data
1082671698_1082671701 15 Left 1082671698 11:56043014-56043036 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1082671701 11:56043052-56043074 GATAGCTCTTTGCCTGCTACTGG No data
1082671699_1082671701 11 Left 1082671699 11:56043018-56043040 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1082671701 11:56043052-56043074 GATAGCTCTTTGCCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082671701 Original CRISPR GATAGCTCTTTGCCTGCTAC TGG Intergenic
No off target data available for this crispr