ID: 1082674776

View in Genome Browser
Species Human (GRCh38)
Location 11:56083475-56083497
Sequence CCCTGGTGGAATGTATCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082674776_1082674783 19 Left 1082674776 11:56083475-56083497 CCTGAAGATACATTCCACCAGGG No data
Right 1082674783 11:56083517-56083539 CACATGTGCCTCCCACCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082674776 Original CRISPR CCCTGGTGGAATGTATCTTC AGG (reversed) Intergenic
No off target data available for this crispr