ID: 1082681380

View in Genome Browser
Species Human (GRCh38)
Location 11:56175880-56175902
Sequence TGACACCTACTAAAAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082681380_1082681382 -10 Left 1082681380 11:56175880-56175902 CCCACTTCTTTTAGTAGGTGTCA No data
Right 1082681382 11:56175893-56175915 GTAGGTGTCATTCAAGAGACAGG No data
1082681380_1082681384 18 Left 1082681380 11:56175880-56175902 CCCACTTCTTTTAGTAGGTGTCA No data
Right 1082681384 11:56175921-56175943 ATTTCATGAGTTTCAGAGTTTGG No data
1082681380_1082681383 -9 Left 1082681380 11:56175880-56175902 CCCACTTCTTTTAGTAGGTGTCA No data
Right 1082681383 11:56175894-56175916 TAGGTGTCATTCAAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082681380 Original CRISPR TGACACCTACTAAAAGAAGT GGG (reversed) Intergenic