ID: 1082682266

View in Genome Browser
Species Human (GRCh38)
Location 11:56189672-56189694
Sequence AACACAGTGCATTAAAATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082682264_1082682266 -7 Left 1082682264 11:56189656-56189678 CCCTTAAGAATATTTTAACACAG No data
Right 1082682266 11:56189672-56189694 AACACAGTGCATTAAAATAATGG No data
1082682265_1082682266 -8 Left 1082682265 11:56189657-56189679 CCTTAAGAATATTTTAACACAGT No data
Right 1082682266 11:56189672-56189694 AACACAGTGCATTAAAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082682266 Original CRISPR AACACAGTGCATTAAAATAA TGG Intergenic
No off target data available for this crispr