ID: 1082682780

View in Genome Browser
Species Human (GRCh38)
Location 11:56198101-56198123
Sequence ACATAATTTCTTTAATTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082682779_1082682780 15 Left 1082682779 11:56198063-56198085 CCTCTGAAAGAGAAAATGCAAAA No data
Right 1082682780 11:56198101-56198123 ACATAATTTCTTTAATTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082682780 Original CRISPR ACATAATTTCTTTAATTAAG AGG Intergenic
No off target data available for this crispr