ID: 1082685062

View in Genome Browser
Species Human (GRCh38)
Location 11:56228007-56228029
Sequence GTCTGCAGTGAACCACAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082685056_1082685062 28 Left 1082685056 11:56227956-56227978 CCCAGCTTTTTGGGAGGCTGAGG 0: 88
1: 10959
2: 215545
3: 446178
4: 475003
Right 1082685062 11:56228007-56228029 GTCTGCAGTGAACCACAATCAGG No data
1082685058_1082685062 27 Left 1082685058 11:56227957-56227979 CCAGCTTTTTGGGAGGCTGAGGC 0: 61
1: 7761
2: 164188
3: 389352
4: 454344
Right 1082685062 11:56228007-56228029 GTCTGCAGTGAACCACAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082685062 Original CRISPR GTCTGCAGTGAACCACAATC AGG Intergenic
No off target data available for this crispr