ID: 1082688086

View in Genome Browser
Species Human (GRCh38)
Location 11:56264392-56264414
Sequence ATTTCACTGGGGATAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082688086_1082688093 7 Left 1082688086 11:56264392-56264414 CCACCCACTATCCCCAGTGAAAT No data
Right 1082688093 11:56264422-56264444 AACATGATTCTCGAGGTATTTGG No data
1082688086_1082688092 0 Left 1082688086 11:56264392-56264414 CCACCCACTATCCCCAGTGAAAT No data
Right 1082688092 11:56264415-56264437 AAAACAAAACATGATTCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082688086 Original CRISPR ATTTCACTGGGGATAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr