ID: 1082688608

View in Genome Browser
Species Human (GRCh38)
Location 11:56271906-56271928
Sequence ATTGGCTACAAAGTGATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082688608_1082688610 3 Left 1082688608 11:56271906-56271928 CCTCTCATCACTTTGTAGCCAAT No data
Right 1082688610 11:56271932-56271954 TTTCCTTTACTCCCAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082688608 Original CRISPR ATTGGCTACAAAGTGATGAG AGG (reversed) Intergenic