ID: 1082688610

View in Genome Browser
Species Human (GRCh38)
Location 11:56271932-56271954
Sequence TTTCCTTTACTCCCAAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082688608_1082688610 3 Left 1082688608 11:56271906-56271928 CCTCTCATCACTTTGTAGCCAAT No data
Right 1082688610 11:56271932-56271954 TTTCCTTTACTCCCAAGTTCTGG No data
1082688607_1082688610 13 Left 1082688607 11:56271896-56271918 CCTATAAAGTCCTCTCATCACTT No data
Right 1082688610 11:56271932-56271954 TTTCCTTTACTCCCAAGTTCTGG No data
1082688606_1082688610 14 Left 1082688606 11:56271895-56271917 CCCTATAAAGTCCTCTCATCACT No data
Right 1082688610 11:56271932-56271954 TTTCCTTTACTCCCAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082688610 Original CRISPR TTTCCTTTACTCCCAAGTTC TGG Intergenic