ID: 1082689752

View in Genome Browser
Species Human (GRCh38)
Location 11:56285600-56285622
Sequence CCTGTTCCCCAAAAAATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082689748_1082689752 11 Left 1082689748 11:56285566-56285588 CCACTAAAAAGCTTGCTCATGTA No data
Right 1082689752 11:56285600-56285622 CCTGTTCCCCAAAAAATGTATGG No data
1082689747_1082689752 29 Left 1082689747 11:56285548-56285570 CCAAAATCTCACAAATCACCACT 0: 1061
1: 1880
2: 1625
3: 962
4: 657
Right 1082689752 11:56285600-56285622 CCTGTTCCCCAAAAAATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082689752 Original CRISPR CCTGTTCCCCAAAAAATGTA TGG Intergenic
No off target data available for this crispr