ID: 1082691256

View in Genome Browser
Species Human (GRCh38)
Location 11:56307798-56307820
Sequence CTGGTAAACATATGTGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082691256_1082691265 27 Left 1082691256 11:56307798-56307820 CCATGCTCACATATGTTTACCAG No data
Right 1082691265 11:56307848-56307870 ATGCATTGGAAGGGTAGTGATGG No data
1082691256_1082691260 13 Left 1082691256 11:56307798-56307820 CCATGCTCACATATGTTTACCAG No data
Right 1082691260 11:56307834-56307856 ATGGTGTGGTGCCCATGCATTGG No data
1082691256_1082691261 17 Left 1082691256 11:56307798-56307820 CCATGCTCACATATGTTTACCAG No data
Right 1082691261 11:56307838-56307860 TGTGGTGCCCATGCATTGGAAGG No data
1082691256_1082691259 -1 Left 1082691256 11:56307798-56307820 CCATGCTCACATATGTTTACCAG No data
Right 1082691259 11:56307820-56307842 GCAGCTGCAGTGTAATGGTGTGG No data
1082691256_1082691257 -6 Left 1082691256 11:56307798-56307820 CCATGCTCACATATGTTTACCAG No data
Right 1082691257 11:56307815-56307837 TACCAGCAGCTGCAGTGTAATGG No data
1082691256_1082691262 18 Left 1082691256 11:56307798-56307820 CCATGCTCACATATGTTTACCAG No data
Right 1082691262 11:56307839-56307861 GTGGTGCCCATGCATTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082691256 Original CRISPR CTGGTAAACATATGTGAGCA TGG (reversed) Intergenic
No off target data available for this crispr