ID: 1082691260

View in Genome Browser
Species Human (GRCh38)
Location 11:56307834-56307856
Sequence ATGGTGTGGTGCCCATGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082691256_1082691260 13 Left 1082691256 11:56307798-56307820 CCATGCTCACATATGTTTACCAG No data
Right 1082691260 11:56307834-56307856 ATGGTGTGGTGCCCATGCATTGG No data
1082691258_1082691260 -6 Left 1082691258 11:56307817-56307839 CCAGCAGCTGCAGTGTAATGGTG No data
Right 1082691260 11:56307834-56307856 ATGGTGTGGTGCCCATGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082691260 Original CRISPR ATGGTGTGGTGCCCATGCAT TGG Intergenic
No off target data available for this crispr