ID: 1082691261

View in Genome Browser
Species Human (GRCh38)
Location 11:56307838-56307860
Sequence TGTGGTGCCCATGCATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082691256_1082691261 17 Left 1082691256 11:56307798-56307820 CCATGCTCACATATGTTTACCAG No data
Right 1082691261 11:56307838-56307860 TGTGGTGCCCATGCATTGGAAGG No data
1082691258_1082691261 -2 Left 1082691258 11:56307817-56307839 CCAGCAGCTGCAGTGTAATGGTG No data
Right 1082691261 11:56307838-56307860 TGTGGTGCCCATGCATTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082691261 Original CRISPR TGTGGTGCCCATGCATTGGA AGG Intergenic
No off target data available for this crispr