ID: 1082696400

View in Genome Browser
Species Human (GRCh38)
Location 11:56370457-56370479
Sequence CTGTTCCAATATAATATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082696398_1082696400 15 Left 1082696398 11:56370419-56370441 CCTGGTAATATGGTTCATCTCTT No data
Right 1082696400 11:56370457-56370479 CTGTTCCAATATAATATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082696400 Original CRISPR CTGTTCCAATATAATATTTA TGG Intergenic
No off target data available for this crispr