ID: 1082698760

View in Genome Browser
Species Human (GRCh38)
Location 11:56402145-56402167
Sequence AGCACCCAGGCCAGCGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082698760_1082698768 5 Left 1082698760 11:56402145-56402167 CCGCAGCCGCTGGCCTGGGTGCT No data
Right 1082698768 11:56402173-56402195 CCTTATTGCCCAGGGCCAGCAGG No data
1082698760_1082698774 28 Left 1082698760 11:56402145-56402167 CCGCAGCCGCTGGCCTGGGTGCT No data
Right 1082698774 11:56402196-56402218 GCCAGCCAGCTGCTCCGAGTGGG No data
1082698760_1082698764 -3 Left 1082698760 11:56402145-56402167 CCGCAGCCGCTGGCCTGGGTGCT No data
Right 1082698764 11:56402165-56402187 GCTAAGCCCCTTATTGCCCAGGG No data
1082698760_1082698769 6 Left 1082698760 11:56402145-56402167 CCGCAGCCGCTGGCCTGGGTGCT No data
Right 1082698769 11:56402174-56402196 CTTATTGCCCAGGGCCAGCAGGG No data
1082698760_1082698773 27 Left 1082698760 11:56402145-56402167 CCGCAGCCGCTGGCCTGGGTGCT No data
Right 1082698773 11:56402195-56402217 GGCCAGCCAGCTGCTCCGAGTGG No data
1082698760_1082698763 -4 Left 1082698760 11:56402145-56402167 CCGCAGCCGCTGGCCTGGGTGCT No data
Right 1082698763 11:56402164-56402186 TGCTAAGCCCCTTATTGCCCAGG No data
1082698760_1082698777 30 Left 1082698760 11:56402145-56402167 CCGCAGCCGCTGGCCTGGGTGCT No data
Right 1082698777 11:56402198-56402220 CAGCCAGCTGCTCCGAGTGGGGG No data
1082698760_1082698776 29 Left 1082698760 11:56402145-56402167 CCGCAGCCGCTGGCCTGGGTGCT No data
Right 1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG 0: 11
1: 51
2: 254
3: 398
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082698760 Original CRISPR AGCACCCAGGCCAGCGGCTG CGG (reversed) Intergenic
No off target data available for this crispr