ID: 1082698761

View in Genome Browser
Species Human (GRCh38)
Location 11:56402151-56402173
Sequence GGGCTTAGCACCCAGGCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1154
Summary {0: 54, 1: 275, 2: 367, 3: 198, 4: 260}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082698761_1082698769 0 Left 1082698761 11:56402151-56402173 CCGCTGGCCTGGGTGCTAAGCCC 0: 54
1: 275
2: 367
3: 198
4: 260
Right 1082698769 11:56402174-56402196 CTTATTGCCCAGGGCCAGCAGGG No data
1082698761_1082698777 24 Left 1082698761 11:56402151-56402173 CCGCTGGCCTGGGTGCTAAGCCC 0: 54
1: 275
2: 367
3: 198
4: 260
Right 1082698777 11:56402198-56402220 CAGCCAGCTGCTCCGAGTGGGGG No data
1082698761_1082698778 25 Left 1082698761 11:56402151-56402173 CCGCTGGCCTGGGTGCTAAGCCC 0: 54
1: 275
2: 367
3: 198
4: 260
Right 1082698778 11:56402199-56402221 AGCCAGCTGCTCCGAGTGGGGGG No data
1082698761_1082698773 21 Left 1082698761 11:56402151-56402173 CCGCTGGCCTGGGTGCTAAGCCC 0: 54
1: 275
2: 367
3: 198
4: 260
Right 1082698773 11:56402195-56402217 GGCCAGCCAGCTGCTCCGAGTGG No data
1082698761_1082698774 22 Left 1082698761 11:56402151-56402173 CCGCTGGCCTGGGTGCTAAGCCC 0: 54
1: 275
2: 367
3: 198
4: 260
Right 1082698774 11:56402196-56402218 GCCAGCCAGCTGCTCCGAGTGGG No data
1082698761_1082698768 -1 Left 1082698761 11:56402151-56402173 CCGCTGGCCTGGGTGCTAAGCCC 0: 54
1: 275
2: 367
3: 198
4: 260
Right 1082698768 11:56402173-56402195 CCTTATTGCCCAGGGCCAGCAGG No data
1082698761_1082698763 -10 Left 1082698761 11:56402151-56402173 CCGCTGGCCTGGGTGCTAAGCCC 0: 54
1: 275
2: 367
3: 198
4: 260
Right 1082698763 11:56402164-56402186 TGCTAAGCCCCTTATTGCCCAGG No data
1082698761_1082698764 -9 Left 1082698761 11:56402151-56402173 CCGCTGGCCTGGGTGCTAAGCCC 0: 54
1: 275
2: 367
3: 198
4: 260
Right 1082698764 11:56402165-56402187 GCTAAGCCCCTTATTGCCCAGGG No data
1082698761_1082698776 23 Left 1082698761 11:56402151-56402173 CCGCTGGCCTGGGTGCTAAGCCC 0: 54
1: 275
2: 367
3: 198
4: 260
Right 1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG 0: 11
1: 51
2: 254
3: 398
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082698761 Original CRISPR GGGCTTAGCACCCAGGCCAG CGG (reversed) Intergenic
900113272 1:1018543-1018565 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
900523110 1:3115690-3115712 GGGCTAGACGCCCAGGCCAGCGG - Intronic
901601475 1:10426591-10426613 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
901783345 1:11608886-11608908 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
901889541 1:12250777-12250799 GGGCTTGGCACACTGGCCGGTGG + Intronic
902100430 1:13983394-13983416 GGACTTAGCACCCGGGCCAATGG - Intergenic
902582397 1:17416328-17416350 GGGCTTTGCACCTTGGCCAAAGG - Intronic
902603088 1:17553189-17553211 GGGATTAGAACCCAGGCAACTGG - Intronic
902644632 1:17789953-17789975 AGGCGTGGGACCCAGGCCAGTGG - Intronic
902674069 1:17996207-17996229 GGGCTGAGGACCCAGCTCAGCGG + Intergenic
903670817 1:25034353-25034375 GGGCTGAGAACCCAGGTCTGTGG - Intergenic
904038883 1:27573035-27573057 GGGCTTATCACCCAAGCCAGTGG - Intronic
904425147 1:30418042-30418064 GGGAGAAGCAGCCAGGCCAGTGG + Intergenic
904498706 1:30902085-30902107 AGACATAGCACCAAGGCCAGGGG + Intronic
904696566 1:32334957-32334979 GGCCTCAGCACCCTGGCTAGGGG + Exonic
905375632 1:37518380-37518402 GGACTTAGCACCCGGGCCAGTGG + Intergenic
905742892 1:40387981-40388003 GGGCTTAGCACCTGGGCCAGCGG + Intronic
907889494 1:58623559-58623581 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
908027751 1:59969896-59969918 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
908291337 1:62670018-62670040 GGACTTAGCACCCGGGCCAGTGG + Intronic
908393349 1:63703224-63703246 GGGCTTTGTGCCCAGGGCAGTGG + Intergenic
908671257 1:66550140-66550162 TGGCCTAGGACCTAGGCCAGTGG - Intronic
908769708 1:67584972-67584994 GGGCTTCGCTCCCAGACCATTGG + Intergenic
908888589 1:68817840-68817862 GGGCTTAGCACCAGGGCCAACGG + Intergenic
909377073 1:74952279-74952301 GGACTTAGCACCCAGGCCAGTGG - Intergenic
909904567 1:81178839-81178861 GGACTTAGCACCCGGGCCAGTGG - Intergenic
910034766 1:82777013-82777035 AGACTTAGCACCCGGGCCAGCGG - Intergenic
910086543 1:83410005-83410027 GTGCTTAGCACACATGCTAGGGG - Intergenic
910609754 1:89128273-89128295 GGACTTAGCACCCGGGCCAGTGG - Intronic
911205923 1:95091495-95091517 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
911259600 1:95669860-95669882 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
911305235 1:96224570-96224592 GGACTTAGCACCCGGGCCAGTGG - Intergenic
911839250 1:102660244-102660266 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
911954494 1:104217676-104217698 GGACTTAGCACCTGGGCCAGTGG - Intergenic
912058124 1:105631467-105631489 GGACTTAGCACCCGGGCCAGCGG - Intergenic
912166158 1:107044897-107044919 AGGCTTAGCACCCGGGCCAGCGG + Intergenic
912312878 1:108641101-108641123 GGACTTAGCACCCGGGCCAGTGG - Intronic
912315930 1:108667604-108667626 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
912486689 1:110034760-110034782 GGGCTTTGCCCCCAGGCAGGAGG - Exonic
912819374 1:112854745-112854767 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
913161067 1:116146787-116146809 AGGCTTAGCACCCGGGCCAGTGG - Intergenic
913692111 1:121289336-121289358 GGACTTAGCACCCGGGCCAGTGG - Intronic
914145445 1:144990778-144990800 GGACTTAGCACCCGGGCCAGTGG + Intronic
914203437 1:145506102-145506124 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
914482559 1:148079256-148079278 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
914928061 1:151906265-151906287 GGGCTTAGCACCCGGGCCAGTGG + Intronic
915104129 1:153521915-153521937 GGACTTAGCACCAGGGCCAGCGG + Intergenic
915199989 1:154220445-154220467 GGGCTGACCAGCCAGGACAGCGG - Exonic
915260054 1:154670879-154670901 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
915261224 1:154678166-154678188 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
915666111 1:157446514-157446536 GAGCTTAGCACCCGGGCCAGCGG - Intergenic
915764492 1:158349221-158349243 AGACTTAGCACCCGGGCCAGCGG - Intergenic
915767161 1:158374386-158374408 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
915865554 1:159494840-159494862 GGGCTCAGCACCCGGGCCAGCGG - Intergenic
916219865 1:162433281-162433303 GGACTTAGCACCCGGGCCAGCGG + Intergenic
916960282 1:169882239-169882261 GTGCTTAGCACCTGGGACAGTGG + Intronic
917578547 1:176349502-176349524 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
917860516 1:179138975-179138997 GGACTTAGCACCTGGGCCAGCGG + Intronic
917932998 1:179837162-179837184 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
917960680 1:180141853-180141875 GGCCACACCACCCAGGCCAGTGG + Intergenic
918059005 1:181045958-181045980 GGGCTTAGCACCCGGGCCAGCGG + Intronic
918659761 1:187074048-187074070 GGACTTAGCACCCGGGCCAGTGG - Intergenic
918708941 1:187703748-187703770 GGGCTTAGCACTCGGACCAGCGG + Intergenic
918720835 1:187850330-187850352 GGGCTTAGTACACGGGCCAGCGG + Intergenic
918732301 1:188013534-188013556 GGGCTCAGCACCTCGGCCAGCGG - Intergenic
918853212 1:189718530-189718552 GGGCTTAGCACCCGGGCCAGAGG - Intergenic
919091902 1:192987039-192987061 GGACTTAGCACCCGGGCCAGCGG + Intergenic
919167952 1:193919144-193919166 GGGCTTAGCACCCAGGCCAGTGG - Intergenic
919174472 1:194001970-194001992 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
919201352 1:194358501-194358523 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
919237041 1:194859202-194859224 GGGCTTAGCACCCGGGCCAACGG + Intergenic
919787227 1:201267023-201267045 GGGAATAGCACCGAGGCTAGAGG - Intergenic
920479434 1:206307684-206307706 GGACTTAGCACCCGGGCCAGTGG - Intronic
920498635 1:206472682-206472704 GGGCCTGGCAGGCAGGCCAGCGG + Intronic
920731370 1:208488670-208488692 GGACTTAGCACCTGGGCCAGCGG - Intergenic
920883152 1:209899032-209899054 GGACTTAGCATCCGGGCCAGTGG - Intergenic
921396385 1:214673378-214673400 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
921801807 1:219410780-219410802 GGACTTAGCACCCGGGCCAGTGG + Intergenic
921897097 1:220412560-220412582 GGACTTAGCACCTGGGCCAGTGG + Intergenic
921903838 1:220475901-220475923 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
921983673 1:221285890-221285912 GGGCTTAGCACCGGGGCCAGTGG - Intergenic
922056825 1:222049874-222049896 GAGCTTAGCACCCAGGCCAGCGG + Intergenic
922423207 1:225472835-225472857 GGACTTAGCACCCGAGCCAGTGG + Intergenic
922485425 1:225969894-225969916 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
922541913 1:226426524-226426546 GGACTTAGCACCCGGGCCAGCGG - Intergenic
922855793 1:228773833-228773855 GGACTTAGCACCCGGGCCAGTGG + Intergenic
922985878 1:229865584-229865606 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
923157233 1:231289707-231289729 GGACTTAGCACCTGGGCCAGCGG - Intergenic
923573816 1:235140422-235140444 GGGCTTAGCACCCGGGCCAGTGG + Intronic
924117519 1:240762617-240762639 GGGCTTAGCACCCGGGCCGGCGG + Intergenic
924219238 1:241855811-241855833 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1063300393 10:4845147-4845169 GGGCTTAGCACTCGGGCCAGCGG - Intronic
1063318731 10:5032750-5032772 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1064197791 10:13259734-13259756 GGACTTAGTACCCGGGCCAGTGG + Intergenic
1064281413 10:13954775-13954797 GGGTTTTGAACCCAAGCCAGTGG - Intronic
1064461016 10:15535064-15535086 GGGCTTAGCACCCGGGCCAGCGG + Intronic
1064790359 10:18951510-18951532 GGACTTAGCACCAGGGCCAGTGG - Intergenic
1065441334 10:25756127-25756149 GGGCTTAGCACCCAGGCCAGTGG + Intergenic
1065743280 10:28815905-28815927 GGACTTGGCACCCGGGCCAGCGG - Intergenic
1065802602 10:29366307-29366329 GGACTTAGCACCTGGGCCAGTGG + Intergenic
1066186304 10:33013420-33013442 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1066189989 10:33047360-33047382 GGGCTTAGTACCCAGGTGATGGG - Intergenic
1066190261 10:33049354-33049376 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1066234044 10:33468162-33468184 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1066235466 10:33480700-33480722 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1066567402 10:36734851-36734873 GCACTTAGCACCCGGGCCAGTGG - Intergenic
1067363191 10:45600870-45600892 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
1068374023 10:56155251-56155273 GGGCTTAGCAGCCGGGCCAGCGG + Intergenic
1068863170 10:61867773-61867795 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1068902114 10:62280506-62280528 GGACTTAGCACCCGGGACAGTGG + Intergenic
1069186522 10:65429640-65429662 GAGCTTAGCACCGTGGCCAGTGG - Intergenic
1069822828 10:71238148-71238170 GGGCTTTCCACCCAGGGCAGGGG - Intronic
1069869094 10:71522334-71522356 GGGGTTAGAAGCCAGGACAGTGG - Intronic
1069988673 10:72300720-72300742 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1069992972 10:72326082-72326104 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1070590922 10:77800472-77800494 GGGCTGAGAACCCAGGCACGGGG + Intronic
1070590933 10:77800506-77800528 GGGCTGAGAACCCAGGCACGGGG + Intronic
1070590944 10:77800540-77800562 GGGCTGAGAACCCAGGCACGGGG + Intronic
1070595312 10:77829014-77829036 GGGCTGGGCAGCGAGGCCAGGGG - Intronic
1070806887 10:79275953-79275975 CGGCTTTGCACCCAGCCAAGTGG + Intronic
1071003758 10:80859368-80859390 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1071037481 10:81265146-81265168 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1071041092 10:81309307-81309329 CGGCTTAGCACCCTAGCCAGCGG - Intergenic
1071085357 10:81862921-81862943 GGGCTTAGCACCTGGGCCAGCGG - Intergenic
1072633860 10:97164929-97164951 AGGGTAAGCCCCCAGGCCAGGGG + Intronic
1072787542 10:98294438-98294460 GGTCTCAGCATCCATGCCAGAGG - Intergenic
1073659777 10:105462250-105462272 GGGCTTAACACCTAGGCGATGGG - Intergenic
1073789773 10:106928335-106928357 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1074314589 10:112349861-112349883 GGGCTCAGCACCTGGGCCAGCGG + Intergenic
1074317148 10:112370439-112370461 GGGCTTAGCACCCCGGCCAGCGG + Intergenic
1074996342 10:118760379-118760401 GGGCTTAGCACCTGGGCTGGCGG - Intergenic
1074999233 10:118783031-118783053 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1075255622 10:120923953-120923975 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1075269379 10:121035571-121035593 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1075537528 10:123283585-123283607 GGGCTTAGTACCCGGGCCGGCGG - Intergenic
1076261657 10:129071584-129071606 GGGCTTAGCACCTGGGCTAGCGG - Intergenic
1076769833 10:132656851-132656873 GGGCTGAGTGCCCAGGCCTGTGG - Intronic
1076905600 10:133359169-133359191 TGGCTTTGCACCGAGGCCACCGG + Intergenic
1077583787 11:3435176-3435198 GGGCTTAGCACCTGGGCCAGTGG - Intergenic
1077805764 11:5590007-5590029 GGGCTTAGCACCCGGGCTAGCGG + Intronic
1078251900 11:9623267-9623289 AGACTTAGCACCCGGGCCAATGG - Intergenic
1078301200 11:10133536-10133558 GGACTTAGCACCCAGGCCAGTGG - Intronic
1078743695 11:14091559-14091581 GGACTTAGCACCCGGGCCAGTGG - Intronic
1078795821 11:14591190-14591212 GGACTTGGCACCCAGGCCAGTGG + Intronic
1079726220 11:23883663-23883685 GGACTTAGCACCTGGGCCAGTGG - Intergenic
1079730571 11:23934981-23935003 GGGCTTAGCACCCGGGCCAGAGG - Intergenic
1079731756 11:23942510-23942532 GGGCTTAGCACCCAGGCCAGAGG - Intergenic
1079767777 11:24416232-24416254 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1080195196 11:29600378-29600400 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1080557693 11:33431975-33431997 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1080621444 11:33990228-33990250 GTACTTAGCACCCGGGCCAGTGG + Intergenic
1081115331 11:39192783-39192805 AGGCTTAGCACCTGGGCCAGCGG - Intergenic
1081125061 11:39311957-39311979 GGACTTAGCACCCGGTCCAGTGG + Intergenic
1081126940 11:39333301-39333323 GAGCTTAGCACCCGGGCCAGTGG - Intergenic
1081329711 11:41788458-41788480 GGGCTTAGCACCCAGGCCAGTGG - Intergenic
1081420896 11:42874046-42874068 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
1081422067 11:42881511-42881533 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
1081428386 11:42950014-42950036 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1082272117 11:50183401-50183423 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
1082698761 11:56402151-56402173 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1083546110 11:63550334-63550356 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1083668339 11:64287036-64287058 GGGCTCAGCCTCCAGGTCAGGGG + Intronic
1084107409 11:66988923-66988945 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1084210461 11:67619165-67619187 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1084276055 11:68051496-68051518 GGGGGTGGGACCCAGGCCAGAGG - Intergenic
1084406081 11:68974481-68974503 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1085245597 11:75098335-75098357 AGGCTTAGCACCCGGGCCAGCGG + Intergenic
1085375885 11:76060693-76060715 GGGCTTAGCACCCGGGCCAGTGG + Intronic
1085447246 11:76609261-76609283 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1085863129 11:80257691-80257713 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1086043034 11:82501287-82501309 GGCCTTAGCACCTGGGCCAGTGG + Intergenic
1086210124 11:84308768-84308790 GGGCTTAGCACCCGGGCCAGTGG - Intronic
1086350100 11:85936004-85936026 GGGCCAAGGACCCAGGCCACAGG - Intergenic
1086808017 11:91268885-91268907 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
1087354540 11:97076729-97076751 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
1088538468 11:110887072-110887094 GGGCCTAGAACCCAGGGCTGTGG - Intergenic
1088570877 11:111222107-111222129 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1088923696 11:114280369-114280391 GGGCTTAGCACCCTTGCCCTAGG - Intronic
1089062122 11:115634125-115634147 GAGCTTAGGACCCGGGCCAGCGG - Intergenic
1089373574 11:117978719-117978741 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1089466406 11:118689206-118689228 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1089555199 11:119312238-119312260 GGGCTGGGGACCCAGGACAGGGG - Intronic
1089621187 11:119723304-119723326 GGGATTCCAACCCAGGCCAGTGG + Intronic
1089800238 11:121021788-121021810 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1090229223 11:125089625-125089647 GGACTTGGCACCCGGGCCAGCGG + Intronic
1090307685 11:125704934-125704956 GGACTTAACACCCGGGCCAGTGG - Intergenic
1090776724 11:129972053-129972075 GGGCTTAGCACCCGGGCCAGTGG - Intronic
1091633128 12:2177209-2177231 GTGCTTAGCAACCAGGAGAGGGG + Intronic
1092142103 12:6191102-6191124 GGGCTTAGCACCCGGGCCGGCGG - Intergenic
1092177327 12:6419154-6419176 GAGCTCAGCGTCCAGGCCAGGGG + Intergenic
1092221400 12:6716165-6716187 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1092272923 12:7037549-7037571 TGACTTAGCACCCGGGCCAGTGG + Intronic
1092336678 12:7639968-7639990 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1092350519 12:7752305-7752327 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1092366554 12:7881411-7881433 GGATTTAGCACCTGGGCCAGCGG + Intronic
1092572422 12:9739808-9739830 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1092583806 12:9876272-9876294 GGGCTTAGCACCCGGGCTAGCGG - Intergenic
1092617154 12:10225860-10225882 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1093034495 12:14320222-14320244 GGGCTTGGCACCCGGGCCAGCGG + Intergenic
1093266272 12:17007752-17007774 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
1093381566 12:18500274-18500296 GAGCTTAGCACCTTGGCCAGCGG + Intronic
1093527089 12:20115461-20115483 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
1093652550 12:21661658-21661680 GGGCTTAGCACCCGGGCCAGCGG + Intronic
1093653942 12:21674284-21674306 GGACTTAGCACCCGGGCCAGCGG - Intronic
1093793714 12:23286054-23286076 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1093970213 12:25369495-25369517 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1093972959 12:25391557-25391579 GGGCTTAGCACCCGAGCCAGCGG + Intergenic
1094338609 12:29386472-29386494 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
1094409835 12:30156999-30157021 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1094448721 12:30561762-30561784 GGACTTAGGACCCGGGCCAGTGG + Intergenic
1094589302 12:31806021-31806043 GGACTTAGCACGCGGGCCAGTGG - Intergenic
1094661282 12:32472420-32472442 GGACTTAGCACCCGGGCCAGTGG + Intronic
1094666487 12:32525802-32525824 GGACTTAGCACCCGGGCCAGTGG + Intronic
1094718197 12:33034163-33034185 GGACTTAGCACCCAGGCCAGCGG - Intergenic
1095776703 12:46018145-46018167 GGGCTTAGCACCTGGTCCAGCGG + Intergenic
1095901542 12:47333513-47333535 GGGCTTAGCACCTGGGCCAGTGG + Intergenic
1097128941 12:56796071-56796093 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1097197441 12:57251079-57251101 GGGCTTAGCCCCCAAGGAAGAGG - Exonic
1098168219 12:67719464-67719486 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1098588669 12:72185174-72185196 GGACTTAGCACCCGGGCCAGTGG + Intronic
1098759241 12:74403075-74403097 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1099559621 12:84155353-84155375 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1099716231 12:86296634-86296656 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1099790711 12:87330344-87330366 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1100166619 12:91924139-91924161 GGGCTTAGCACCGGGGCCAGCGG - Intergenic
1100211885 12:92406750-92406772 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
1100584697 12:95969263-95969285 GGACTTAGCACGCGGGCCAGTGG + Intergenic
1101021623 12:100559510-100559532 GGACTTAGCACCCGGGCCAGTGG + Intronic
1101461963 12:104905744-104905766 GGACTTAGCACCCGGGCCAGTGG - Intronic
1101914785 12:108887590-108887612 GGGATGAGCACCCAGGGCTGGGG + Intronic
1102197664 12:111035995-111036017 GGGCTTGGCACGAAGGCCAATGG + Intronic
1102309757 12:111835782-111835804 GGGCTTAGCACACGGGCCAGTGG + Intergenic
1103146146 12:118597407-118597429 GGACTTGGCACCCGGGCCAGCGG - Intergenic
1103668545 12:122592153-122592175 GGGCTTAGCACCCGGGCCAGCGG + Intronic
1103783396 12:123414345-123414367 GGGCTTAGCACCCGGGCCAGCGG - Exonic
1103938890 12:124491179-124491201 GGGCTTTGCCCCTAGGGCAGGGG - Intronic
1104582638 12:130022183-130022205 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1104614517 12:130256886-130256908 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1104749237 12:131227940-131227962 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1104927160 12:132319792-132319814 AGGCTGGGCACCCAGGCCCGAGG - Intronic
1105037750 12:132938882-132938904 GGACTTAGCACCCGGGCCAGTGG + Intronic
1105425645 13:20292545-20292567 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1105704384 13:22960359-22960381 GGGCTGGGCACCCAGGAGAGAGG + Intergenic
1105722172 13:23127700-23127722 GGACTTAGCACCCAGGCCAGCGG + Intergenic
1105857335 13:24385411-24385433 GGGCTGGGCACCCAGGAGAGAGG + Intergenic
1105876685 13:24560937-24560959 GGGCTTAGCACCTGGGCCAGCGG - Intergenic
1106617066 13:31339898-31339920 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1106643433 13:31609059-31609081 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1106810947 13:33358109-33358131 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1107259383 13:38472662-38472684 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1107590466 13:41898811-41898833 GGACTTAGCACCCGGGCCAGCGG - Intronic
1107836113 13:44413703-44413725 GGGCTTAGCACCCGGGCCAGAGG + Intergenic
1108099180 13:46936287-46936309 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1108213493 13:48161232-48161254 GGGCTTAGCAGCCATGACAGGGG + Intergenic
1108435340 13:50396723-50396745 GGGCTTAGCTCCCGGGCCAGCGG + Intronic
1108469459 13:50753539-50753561 GGGCTTAGCAACCGGGCCAGCGG - Intronic
1108663633 13:52608088-52608110 GGGCACAGAACCCAGCCCAGAGG + Intergenic
1108751535 13:53452625-53452647 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1108851616 13:54737508-54737530 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1108858961 13:54829732-54829754 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1109124703 13:58504458-58504480 GGGCTTAGCACCTGGGCCAGCGG - Intergenic
1109141046 13:58714211-58714233 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1109159874 13:58958414-58958436 GGGCTTAGCACCTGGGCCAGCGG - Intergenic
1109441367 13:62379356-62379378 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1109745818 13:66622077-66622099 GGGCTTAGCACCCGGGCCAGCGG + Intronic
1110368866 13:74718520-74718542 GGACTTAGCACCCGGGCCGGCGG + Intergenic
1110417482 13:75268577-75268599 GGACTTAGCAACCGGGCCAGCGG + Intergenic
1110751395 13:79119853-79119875 GGGCTTAGCACCTGGGCAAGCGG - Intergenic
1110792394 13:79600390-79600412 GGGCTTAGCACCCGGGCTGGCGG - Intergenic
1110862132 13:80355675-80355697 GGGCTTAGCACCCGGCCCAGCGG + Intergenic
1110874370 13:80490794-80490816 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1110999848 13:82165182-82165204 GAGCTTAGCACCTGGGCCAGCGG - Intergenic
1111591021 13:90348727-90348749 GGGTTTAGCACCCTGGCTAGTGG + Intergenic
1111602720 13:90494908-90494930 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1111748323 13:92296794-92296816 GGACTTAGCACCCAGGCCAGTGG + Intronic
1111841415 13:93455017-93455039 GGGCTTAGCACCCGGGCCAGAGG - Intronic
1112518644 13:100077644-100077666 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
1112538266 13:100282556-100282578 GGGCTTAGCACCCGGGCCAGCGG + Intronic
1112613094 13:100975824-100975846 GGACTTATCGCCCAGGCCAGCGG + Intergenic
1112705850 13:102068602-102068624 CGACTTGGCACCCGGGCCAGCGG + Intronic
1113057419 13:106284110-106284132 GGGCTGACCAACCAGGCCATGGG - Intergenic
1113482686 13:110633261-110633283 GGACTTAGCACCCGGGCCAGCGG - Intronic
1113506636 13:110821288-110821310 GGACTTAGCACCTGGGCCAGTGG + Intergenic
1113538134 13:111084104-111084126 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1113678053 13:112221845-112221867 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1113948388 13:114057801-114057823 GTGCTGAGCGCCCTGGCCAGAGG - Intronic
1114560309 14:23585114-23585136 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1114593532 14:23891885-23891907 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1116114503 14:40629872-40629894 GGGCTTAGCATCCGGGCCAGCGG - Intergenic
1116239728 14:42324998-42325020 GGGCTCAGCAGCCATGCAAGGGG + Intergenic
1116251036 14:42482623-42482645 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1116390525 14:44384871-44384893 GGGCTTAGCACCCCGGCCAGCGG + Intergenic
1116452360 14:45080565-45080587 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
1116624014 14:47242572-47242594 GGACTTAGCACCCGGGCCAGTGG + Intronic
1116984372 14:51203858-51203880 GGGTTTAGCACACTGCCCAGGGG - Intergenic
1117297566 14:54393569-54393591 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
1117302510 14:54443180-54443202 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
1117449818 14:55839637-55839659 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
1117565629 14:56991148-56991170 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1117571924 14:57056847-57056869 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1118149905 14:63178537-63178559 GGGCTCAGCAGCCAGGCTGGGGG + Intergenic
1118215371 14:63803496-63803518 GGACTTAGCACCCGGACCAGTGG - Intergenic
1119038841 14:71254425-71254447 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
1119300320 14:73566565-73566587 GGGCTTAGCACCTGGGCCAGCGG - Intergenic
1119486777 14:74994277-74994299 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1119673451 14:76536982-76537004 GGACTTAGCATCTGGGCCAGCGG - Intergenic
1119870705 14:78014213-78014235 GGACTTAGCACCCAGGCCAGTGG - Intergenic
1120330981 14:83092513-83092535 GGATTTAGCACCCGGGCCAGCGG + Intergenic
1120429751 14:84399596-84399618 GGGCTTAGCATCCGGGCCAGCGG - Intergenic
1120439114 14:84513141-84513163 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1120844163 14:89111776-89111798 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1121350665 14:93170349-93170371 GGACTTAGCACCCAGGCCAGCGG - Intergenic
1122116290 14:99528887-99528909 GGGCTTATTACCTAGGCCATGGG + Intronic
1122271579 14:100570704-100570726 GGGCGTAGCACCTCGGCCAGGGG - Intronic
1122356650 14:101126784-101126806 GGGCTATGAGCCCAGGCCAGGGG - Intergenic
1122493460 14:102135742-102135764 GGACTTAGCACCCGGGCCAGTGG - Intronic
1122533032 14:102442370-102442392 TGGCTGTGCACCCAGGCCAGAGG - Intronic
1122789557 14:104178592-104178614 GGGCTTACGGCCCAGGGCAGTGG - Exonic
1123052177 14:105549805-105549827 GGCCTCCGCACCCAGGCCTGGGG - Intergenic
1202848752 14_GL000225v1_random:2244-2266 GGGGTCTCCACCCAGGCCAGGGG - Intergenic
1124573126 15:30883885-30883907 GGACTTAGCACCCTGGCCAGTGG + Intergenic
1125462581 15:39920627-39920649 GGGCTTTCCACCCAAGCCATGGG - Exonic
1125480293 15:40075005-40075027 GGACTTAGCACCCAGGCCAGCGG - Intergenic
1125519221 15:40338977-40338999 GGGGTTGGAACCCAGGCCTGGGG - Intronic
1125565754 15:40677159-40677181 GGGCTTAGCACTCGGGCCAGCGG - Intergenic
1125914551 15:43474108-43474130 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1126088990 15:45034963-45034985 GGGCTTAGCACCCGGGCCAGCGG + Intronic
1126128076 15:45314221-45314243 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1126382737 15:48065738-48065760 GGCCTTAGCCACCAGGCAAGGGG - Intergenic
1126639671 15:50812097-50812119 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1128053811 15:64684982-64685004 GGGCTGAGCACCAAGGCAAGCGG - Exonic
1128110843 15:65075153-65075175 GGACTTTGCACCCGGGCCAGTGG + Intronic
1128424136 15:67521877-67521899 TGGCTTACTGCCCAGGCCAGGGG - Intronic
1128598574 15:68975901-68975923 GGGTTTAGCACCCGGGCCAGTGG - Intronic
1128669981 15:69567590-69567612 GGACTTAGCACACGGGCCAGCGG - Intergenic
1128813309 15:70587406-70587428 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1129859163 15:78847002-78847024 GGACTTAGCACCCGGGCCAGTGG + Intronic
1129986900 15:79926240-79926262 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
1130132862 15:81158751-81158773 GGGCTTAGCGCCCGGGCCAGCGG + Intergenic
1131174564 15:90201693-90201715 GGGCTGAGCGCCCAGGTCGGAGG - Exonic
1131507784 15:93031956-93031978 GGACTTAGCACCCAGGCCAGTGG + Intergenic
1131533059 15:93211175-93211197 GGGCTTAGCACCCAGAGAAGAGG - Intergenic
1131846124 15:96492069-96492091 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1132013078 15:98292911-98292933 GGGCCCAGCTCCCAGCCCAGGGG - Intergenic
1132147195 15:99436076-99436098 GGGCTTGGCACCCAGGTTTGTGG + Intergenic
1132175645 15:99711859-99711881 GGGCTCAGAGCCCAGGCCCGGGG + Intronic
1132511016 16:341392-341414 GGGCTTAGCACCCGGGCCAGCGG + Intronic
1132655952 16:1041717-1041739 AGGCCTGGCACCCAGGGCAGAGG - Intergenic
1132836824 16:1958431-1958453 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1132930204 16:2455163-2455185 GGGCTTCACACCCAGACCTGGGG + Intronic
1133108306 16:3528627-3528649 GGTCTTAGCATCCTGGCCCGGGG - Intronic
1135280849 16:21152726-21152748 GGGCTTAGCACCCCGGCCAGCGG + Intronic
1135299395 16:21313012-21313034 GGACTTAGCACCCAGGCCAGTGG - Intergenic
1135751067 16:25059142-25059164 GGGCTTAGCACCAGGGCCAGCGG - Intergenic
1136070142 16:27782588-27782610 GGGCTTCGCAGCCAGGCAGGTGG + Intergenic
1137442507 16:48508818-48508840 GGGCTTAGCACCTGGGCCAGTGG + Intergenic
1138693604 16:58791001-58791023 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1139125540 16:64072560-64072582 AGGCTTAGCACCCGGGCCAGCGG - Intergenic
1139147731 16:64344023-64344045 GAGCTTAGCACCCGGGCCAGCGG + Intergenic
1139308285 16:66006627-66006649 TGGCCCAGCACTCAGGCCAGAGG + Intergenic
1139324705 16:66143497-66143519 GAGCTTTGCCACCAGGCCAGTGG + Intergenic
1139603050 16:67998343-67998365 GGGCTTGGCACCCGGGCCAGTGG + Intronic
1139919591 16:70451028-70451050 GGGCTTAACACCCCGACCAGCGG - Intergenic
1140722524 16:77784610-77784632 GAGCTTAGCACCAGGGCCAGCGG - Intergenic
1141465749 16:84204847-84204869 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1141685693 16:85568643-85568665 GGGCTTATTACCCAGGGCGGAGG + Intergenic
1141755978 16:85991195-85991217 GTGATTAGCAGCCAGGCCGGTGG + Intergenic
1142505666 17:361722-361744 GAACTTAGCACCCGGGCCAGCGG + Intronic
1142766202 17:2065614-2065636 GGGCGTAGCCCCCAGCCCGGTGG + Exonic
1142769192 17:2084433-2084455 GGGCTCAGCTTCCAGGACAGAGG - Intronic
1143664278 17:8347351-8347373 GGGCTTAGCACCCGGACCAGCGG - Intergenic
1144494100 17:15736187-15736209 GGGCTTCTCACTGAGGCCAGGGG + Intronic
1144627697 17:16853078-16853100 GGGCTCAGCATCCTGGCCAAGGG - Intergenic
1144650084 17:17001968-17001990 GGGCCCAGCACCTAGGTCAGCGG - Intergenic
1144906160 17:18640489-18640511 GGGCTTCTCACTGAGGCCAGGGG - Intronic
1145963391 17:28900764-28900786 GGGCTGAGGACCCAGGCTTGTGG + Intronic
1146058974 17:29594597-29594619 GCCCTTGGCACCCAGGCCACAGG + Intronic
1146740470 17:35279146-35279168 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1147373622 17:40011063-40011085 AGGCTTAGCACCCGGGCCAGCGG + Intergenic
1147431818 17:40375963-40375985 GGGCTTAGCATCCGGGCCAGCGG + Intergenic
1147990220 17:44327990-44328012 GTGCTTAGAACCCTGGCAAGTGG + Intergenic
1147997533 17:44368952-44368974 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1148016873 17:44528103-44528125 GGGTTTAGCACCCGGGCCAGCGG + Intergenic
1148366178 17:47057514-47057536 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
1148974676 17:51516609-51516631 GGGCTTAGTACCTAGGCGATGGG + Intergenic
1149099264 17:52884207-52884229 GGGCTAAGCACCCAGGCCAGCGG - Intronic
1149316530 17:55444064-55444086 GGGCTTATTACCCAGGTCTGCGG + Intergenic
1149657076 17:58315868-58315890 GGGCTGAGCACGCTGGGCAGAGG + Intronic
1149867091 17:60157086-60157108 GGGCAGATCACCCAGGCCTGAGG + Intronic
1150230403 17:63546532-63546554 TGGCTCAGCACCAAGGCCCGGGG + Exonic
1150772281 17:68052001-68052023 GGGCTTAGCACCCGGACCAGCGG + Intergenic
1150778279 17:68099411-68099433 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1150786753 17:68169589-68169611 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1151782679 17:76257879-76257901 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1151877125 17:76873157-76873179 GGCCTGAGAATCCAGGCCAGAGG - Intronic
1152216066 17:79033341-79033363 GGTCTCAGCAGCCAGGTCAGTGG + Intronic
1152619054 17:81352279-81352301 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1152740204 17:82015413-82015435 AGGCTTGGCAGCCAGGCCTGGGG - Intronic
1152939452 17:83160524-83160546 GGGCTGAGCACCCAGGAGTGAGG - Intergenic
1153644058 18:7178897-7178919 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1153832465 18:8935654-8935676 GGACTTAGCACCCTGGCCAGTGG - Intergenic
1154057244 18:11023878-11023900 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1155208052 18:23577862-23577884 GGACTTAGCACCCGGGCCAGTGG - Intronic
1155271957 18:24149785-24149807 GGGCTTAGCACCCAGGCCAGTGG - Intronic
1155295035 18:24376811-24376833 GAGCTTAGCACCCGGGCCAGCGG - Intronic
1155544128 18:26898016-26898038 GGGCTTAATACCCAGGCGATGGG - Intergenic
1155772874 18:29723646-29723668 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1155856380 18:30839390-30839412 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1156038668 18:32794703-32794725 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1156863658 18:41865886-41865908 GAACTTGGCACCCGGGCCAGCGG + Intergenic
1156943166 18:42795361-42795383 GGACTTAGCACCCGGGCCAGCGG + Intronic
1157085967 18:44580862-44580884 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1157979802 18:52367135-52367157 GGGCTTAGCACACGGGCCAGTGG - Intronic
1158351919 18:56572419-56572441 GGGCTTAGCACCGGGGCCAGCGG + Intergenic
1158697262 18:59714324-59714346 GGACTTGGCACCCGGGCCAGCGG - Intergenic
1158705757 18:59790683-59790705 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1159167953 18:64725861-64725883 GGACTTAGCACCCGGGCCAGGGG - Intergenic
1159230798 18:65605383-65605405 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1159472950 18:68880226-68880248 GGGCTTAGCACCTGGGCCAGTGG - Intronic
1159656108 18:71031570-71031592 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1159907947 18:74115144-74115166 GGGCTCAGCTCCCAGGCCAGTGG - Intronic
1160198553 18:76777374-76777396 GGGCTTAGCACCCGGGCCAACGG + Intergenic
1160292850 18:77609599-77609621 GGGCTCAGAGCCCAGGGCAGAGG + Intergenic
1160422192 18:78754832-78754854 GGGGTGAGAAGCCAGGCCAGTGG + Intergenic
1160773250 19:843303-843325 GGACTCAGCGCCCAGGCCGGGGG - Intronic
1160841895 19:1150050-1150072 GGGCTGAGCCTCCAGGCCACTGG - Intronic
1162230143 19:9259642-9259664 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1162233113 19:9283685-9283707 GGGCTTAGCAACCGGGCCAGCGG - Intergenic
1162237642 19:9321522-9321544 GGTCTTAGCACCCGGGCCAATGG + Intergenic
1162632704 19:11941527-11941549 GGGCTTAGCACCTGGGCCAGCGG - Intronic
1163061033 19:14761892-14761914 GGACTTCCCACCCATGCCAGAGG - Intronic
1163218845 19:15899812-15899834 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1163618373 19:18342783-18342805 GGGAGTAGCGGCCAGGCCAGGGG + Intronic
1164002012 19:21109695-21109717 GGGCTTATCACCGAGGTGAGGGG - Intronic
1164008527 19:21175525-21175547 GGGCTTATCACCGAGGTGAGAGG - Intronic
1164144030 19:22499220-22499242 GGGCTTAGCACCTGGGCCAACGG - Intronic
1164270588 19:23668758-23668780 GGACTTAGCACCCGGGCCAGCGG - Intronic
1164310459 19:24041443-24041465 GGACTTAGCACCCGGGCTAGTGG + Intronic
1164576062 19:29405853-29405875 GGGCTCAGAACCCACGCCTGTGG - Intergenic
1164975792 19:32571717-32571739 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1166036223 19:40170372-40170394 GGGCTTAGCGCCTGGGCCAGCGG - Intergenic
1166487018 19:43222163-43222185 GGGCTTAGCACCCGAGCCAGCGG - Intronic
1166649725 19:44563436-44563458 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1168722685 19:58562861-58562883 GGGCTTAGCGCCAGGGCCCGGGG + Exonic
925088703 2:1134954-1134976 GGGCTTAGCCCCCTGGCCAGCGG - Intronic
925098978 2:1229830-1229852 GGACTTAGCACCCGGGCCAGCGG - Intronic
925230034 2:2225272-2225294 GGGGTTACCAACCAGGGCAGGGG + Intronic
925537812 2:4935545-4935567 GGACTTAGCACCCGGGCCAGCGG - Intergenic
926170617 2:10550591-10550613 GGGGCTTGCATCCAGGCCAGTGG + Intergenic
927490762 2:23519414-23519436 GGCCTTGGCACACTGGCCAGGGG - Intronic
927680560 2:25136386-25136408 GGGCTGAGAACCAGGGCCAGGGG + Intronic
928493078 2:31803832-31803854 GGCCTTAGCACCCGGGCCAGCGG + Intergenic
928610322 2:32986199-32986221 GCTCTTAGCAGCCAGGGCAGAGG + Intronic
928753192 2:34494422-34494444 GGACTTAGCACCCAGGCCAGTGG + Intergenic
928787109 2:34901785-34901807 GGGATTAGAACCCAGGTCATTGG - Intergenic
928789789 2:34936265-34936287 GGGCTTGGCTGCCATGCCAGAGG + Intergenic
928936895 2:36688390-36688412 GGGCTTAGCACCCGGGCTAGCGG + Intergenic
929070055 2:38020640-38020662 GGGCTTAGCACCCAGGCCAGCGG + Intronic
929201854 2:39244404-39244426 GGACTTAGCACCCGGGCCAGCGG + Intergenic
929379685 2:41335719-41335741 GGACTTGGCACCCGGGCCAGCGG + Intergenic
930039211 2:47107409-47107431 GGGCTTAGCACCCGGGCCAGCGG + Intronic
930485504 2:52006928-52006950 GGACTTGGCACCCGGGCCAGCGG + Intergenic
931014111 2:57955645-57955667 GGGCTTAACACCCAGGTGATAGG + Intronic
931708689 2:64969133-64969155 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
932359523 2:71092719-71092741 TGGCTTAGCACCCGGGCCAGTGG - Intergenic
932434061 2:71692812-71692834 GGGGAGAGCTCCCAGGCCAGTGG - Intergenic
932486473 2:72087010-72087032 GGACTTAGCACCCGGGCCAGTGG + Intergenic
932521768 2:72421956-72421978 GGACTTAGCACCCGGGCCAGTGG + Intronic
932579778 2:72985620-72985642 GGACTCAGCAGCCAGGCCAGAGG + Intronic
932902047 2:75711703-75711725 GGACTTGGCACCCGGGCCAGCGG + Intergenic
933487260 2:82938677-82938699 GGACTTAGCACCCGGGCCAGCGG - Intergenic
935896855 2:107747570-107747592 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
936346885 2:111681979-111682001 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
936581525 2:113704636-113704658 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
937181138 2:119997112-119997134 GAGCTTAGCACCCGGGCCAGAGG + Intergenic
937209599 2:120259982-120260004 GGACTTAGCAGCCAGGCCAGTGG - Intronic
937596846 2:123683902-123683924 GGACTTAGCACCCAGGCCAGTGG + Intergenic
937682368 2:124657633-124657655 GGGTTTTGCTTCCAGGCCAGAGG - Intronic
937711853 2:124987641-124987663 GGACTTAGCACCCGAGCCAGTGG - Intergenic
937746594 2:125422377-125422399 GGACTTAGCACCCGGGCCAGTGG + Intergenic
938259635 2:129885993-129886015 GGGGCTAACAGCCAGGCCAGAGG - Intergenic
938295369 2:130175117-130175139 GGGCTGGGGAACCAGGCCAGAGG - Intronic
938401026 2:130991574-130991596 GGAATTAGCACCCGGGCCAGCGG + Intronic
938461251 2:131498711-131498733 GGGCTGGGGAACCAGGCCAGTGG + Intergenic
938726032 2:134109577-134109599 GGGCTTAGCACCTGGGCCAGAGG - Intergenic
938749012 2:134310919-134310941 TGGCTGAGCAGCCAGGCCAGTGG + Intronic
939053216 2:137331839-137331861 GGGCTTAGCACCCGGGCCAGCGG - Intronic
939229756 2:139410469-139410491 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
939275209 2:139990931-139990953 GAGCTTAGCACCCGGGCCAGCGG - Intergenic
939281749 2:140073918-140073940 GGACTTAGCACCCAGGCCAGCGG + Intergenic
939465126 2:142546189-142546211 GGACTTAGCACCTGGGCCAGTGG + Intergenic
939738780 2:145881132-145881154 GGGCTTAGCAGTCTGGCCAGCGG - Intergenic
939777359 2:146403923-146403945 GGACTTAGCACCCGGGCCAGTGG - Intergenic
939972545 2:148678632-148678654 GGGCTTAGCACCCGGGCCAGCGG - Intronic
940666709 2:156618289-156618311 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
940907324 2:159180839-159180861 GGGCTTCCCACACAGGGCAGGGG + Intronic
941043468 2:160648468-160648490 TGGCTCAGCTCCCAGGGCAGTGG - Intergenic
941240082 2:163026404-163026426 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
941309781 2:163913742-163913764 GGGCTTAGCACCCAAGGCAGCGG + Intergenic
941705873 2:168657670-168657692 GGACTTAGCACCCGGGCCAGTGG - Intronic
941712125 2:168725129-168725151 GGGCTTAGCACCCGGGCCAGCGG - Intronic
941820789 2:169841662-169841684 GGACTTAGCACCCGGGCCAGTGG + Intronic
942540183 2:177007980-177008002 GGGCTTAGCGCCCGGGCCAGCGG + Intergenic
942751212 2:179289458-179289480 GTGCTTATCACCCAGGCTGGAGG - Intergenic
942867287 2:180691516-180691538 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
943449360 2:188028690-188028712 GGGTGTAGTTCCCAGGCCAGTGG + Intergenic
943680345 2:190761186-190761208 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
943835157 2:192508097-192508119 GGGCTTAGCACCCAGAACAGCGG + Intergenic
944228428 2:197370699-197370721 GGGCTAAGCACCCCGGCCAGCGG + Intergenic
944485376 2:200199859-200199881 GGGCGTGGCTCCCAGGCCAATGG - Intergenic
944728596 2:202497039-202497061 GGGCTTAGCACCCGGGCCAGCGG + Intronic
944857939 2:203785806-203785828 GGGCTTAGCACCCAGGCCAGTGG - Intergenic
945401395 2:209387507-209387529 GGGCTTAGCACCTGGGCCATCGG + Intergenic
945575479 2:211524609-211524631 GGGCGTAGCACCCGGGCCAGCGG - Intronic
945745779 2:213718620-213718642 GGACTTAGCACCCGGGCCAGTGG + Intronic
946165313 2:217859977-217859999 GGGCTTTGCGGCCAGGCCAGTGG + Intronic
946358086 2:219201659-219201681 GGACTTAGCACCCGGGCCAGTGG - Intronic
946431938 2:219630861-219630883 GGGCTCTGTGCCCAGGCCAGGGG + Intronic
946923571 2:224603933-224603955 GGACTTAGCACCCGGGCCAACGG - Intergenic
946982170 2:225229680-225229702 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
947026625 2:225744262-225744284 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
947411991 2:229850846-229850868 GGGCTCAGCACCCGGGCCAGCGG + Intronic
947720420 2:232366469-232366491 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
947932061 2:233972700-233972722 AGGTTTAGCACCCGGGCCAGTGG - Intronic
948220788 2:236268034-236268056 GGGCTTTGCTCCCAGGACAGAGG + Intergenic
948449113 2:238058085-238058107 GGGCTTAGCACCCGGGCCAGCGG - Intronic
948865625 2:240773353-240773375 GGGCTCAGCAGCCAGGCCAAAGG + Intronic
949044770 2:241867343-241867365 GGCCCTAGGACCCAGGCCTGGGG - Intergenic
1169263326 20:4153154-4153176 GGGCTCCGGACCCAGGCCAATGG + Intronic
1169488996 20:6055733-6055755 GGGGTCAGCACGCAGACCAGTGG + Intergenic
1169814456 20:9641820-9641842 GAACTTAGCACCTGGGCCAGTGG - Intronic
1170246465 20:14226636-14226658 GGGCTTAGCACCCGGGCCAGCGG + Intronic
1170649497 20:18226894-18226916 GGGCTTAGAACCCAGGCCAATGG + Intergenic
1170806852 20:19639862-19639884 GGGCTTAGCACCTGGGCCAGCGG - Intronic
1171318854 20:24220952-24220974 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1172220058 20:33267828-33267850 GGGGTTAGCGCCCAGTGCAGGGG - Intergenic
1173195529 20:40910701-40910723 GGACTTAGCACCTGGGCCAGTGG - Intergenic
1173195683 20:40911312-40911334 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1173601592 20:44299262-44299284 AGGCTTAGCACCCAGGCCAGCGG + Intergenic
1174576679 20:51542333-51542355 GGGCTCAGGGGCCAGGCCAGGGG + Intronic
1175210065 20:57348525-57348547 GGGCTTGGCACCCGGGCCAGCGG + Intergenic
1175254149 20:57628923-57628945 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1175894126 20:62328566-62328588 AGGCTCAGCACCCGGGGCAGGGG - Intronic
1176966620 21:15218807-15218829 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1177565830 21:22819071-22819093 GGGCTTAGCACCCTGGCCAGCGG - Intergenic
1178326995 21:31654322-31654344 GGGCTTAGCACCAGGGCCAGCGG + Intergenic
1178398740 21:32265460-32265482 GGACTTAGCACCTGGGCCAGTGG + Intergenic
1178585648 21:33868548-33868570 GGACTTAGCACCCGGGCCAGCGG - Intronic
1178983354 21:37283416-37283438 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1179226240 21:39455725-39455747 GGTCTTAGGATCCAGGCCAGAGG - Intronic
1179979999 21:44890895-44890917 GGGCTGCACACCCAGGACAGTGG + Intronic
1180224900 21:46386508-46386530 GGGCTGAGCGCCCAGCCCCGAGG + Intronic
1180741047 22:18053588-18053610 GGGCTTAGCCCCCGGGCCAGCGG - Intergenic
1181022205 22:20109499-20109521 GGGGCTCTCACCCAGGCCAGGGG - Intronic
1181047567 22:20222864-20222886 TGTCTGGGCACCCAGGCCAGGGG + Intergenic
1181817012 22:25446065-25446087 GGGATTTGAACCCAGGCCATAGG - Intergenic
1182321806 22:29482519-29482541 GGGGTTGGCACCCAGGCCACGGG + Intronic
1183006588 22:34907966-34907988 GGACTTAGGGCCCAGGCAAGGGG - Intergenic
1183422125 22:37718071-37718093 GGGCTTAGCACCTGGGCCAGCGG - Intronic
1183685238 22:39357728-39357750 GGACTTAGCGCCCGGGCCAGCGG + Intronic
1184512762 22:44942938-44942960 GAGCTTAGGACACAGGCCTGAGG + Intronic
1184584252 22:45436857-45436879 GAGCTTAGCACCCGGGCCAGTGG + Intergenic
1184906257 22:47488538-47488560 GCGCTTAGCACCCGGGCCAGTGG - Intergenic
1185370060 22:50456758-50456780 GGGCTGAGCTCCCAGGGCAGGGG + Intronic
949258972 3:2083756-2083778 GGGCTTAGCACCCCGGCCAGCGG + Intergenic
949281486 3:2352521-2352543 AGGCTTAGCACCTGGGCCAACGG + Intronic
949769989 3:7568725-7568747 GGGCTTAGCACCCGGGCCAGCGG + Intronic
950041174 3:9920433-9920455 GGGCTCAGAATCCAGGCCAAGGG - Intronic
950256656 3:11511827-11511849 GGACTTAGCACCTGGGCCAGTGG - Intronic
950256964 3:11513474-11513496 GGGCTTAGCACCCAGGCCAGCGG - Intronic
950513368 3:13447428-13447450 GGACTTAGCACCCGGGCCAGTGG - Intergenic
950600381 3:14029726-14029748 GGGCTTAGCACCCGGGCCAGCGG - Intronic
950682502 3:14594696-14594718 GGGATTTGAACCCAGGCTAGAGG - Intergenic
950802115 3:15561210-15561232 GGGCTGAGCTCCCAGGTCTGAGG + Intronic
950929394 3:16773845-16773867 GGGCTTAGCACCAGGGCCAGCGG + Intergenic
951064008 3:18243075-18243097 GGGCTTAGCAAGCAGGATAGGGG + Intronic
951339956 3:21473269-21473291 TGGCTCAGCACCCATGCCAAAGG + Intronic
951951090 3:28200644-28200666 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
952275246 3:31870248-31870270 GGGCTTAGCACCTGGGCCAGTGG + Intronic
952355386 3:32578881-32578903 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
952360471 3:32625773-32625795 GGGCTTAGCATCTGGGCCAGCGG + Intergenic
952393712 3:32902923-32902945 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
952398229 3:32939812-32939834 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
952593634 3:34988505-34988527 GGGTTTAGCACCCGGGCCAGCGG + Intergenic
952730639 3:36634036-36634058 GGGCTTAGCACCCCGGCCAGCGG + Intergenic
953002888 3:38951280-38951302 GGGCTTGGCACCCGGGCCAGTGG + Intergenic
953089822 3:39713445-39713467 GGACTTAGCACCCCGGCCAGTGG + Intergenic
953124516 3:40078158-40078180 GGGCTTAGCACCCGGGCCAGCGG - Intronic
953307612 3:41844400-41844422 GAGCTTAGCACCTGGGCCAGCGG - Intronic
953522495 3:43656658-43656680 GGACTTAGCATCCGGGCCAGCGG - Intronic
954041006 3:47887335-47887357 GGACTTAGCACCCGGGCCAGTGG + Intronic
954620127 3:51990701-51990723 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
955104131 3:55879854-55879876 TGGCTTAAAACCCTGGCCAGTGG + Intronic
955183349 3:56692008-56692030 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
955186425 3:56719061-56719083 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
955210283 3:56934594-56934616 GGACTTAGCACCCGGGCCAGCGG + Intronic
955266461 3:57449577-57449599 GGACTTAGCACCTGGGCTAGTGG - Intronic
955449482 3:59050987-59051009 GGACTTAGCACCCGGGCCAGTGG + Intergenic
956481457 3:69677582-69677604 GGACTTAGCACCCTGGCCAGCGG + Intergenic
956647942 3:71475185-71475207 GGGGTTAGCATCCAGGAGAGAGG - Intronic
956855254 3:73269322-73269344 GGACTTAGCACCCGGGCCAGTGG + Intergenic
957009185 3:74985357-74985379 GGGCTTAGCACCTGGGCCAGCGG - Intergenic
957277460 3:78108517-78108539 GAGCTTAGCACCCCGGCCAGCGG + Intergenic
957362073 3:79173465-79173487 GAGCTTAGCACCCAGGCCAGTGG + Intronic
957419672 3:79951602-79951624 GGGCTTAGAACCCTGGCCAGCGG - Intergenic
957556300 3:81767618-81767640 GGGCTTAGCACCCTGGCCAGCGG - Intergenic
957560167 3:81812240-81812262 GGGCTTAGCACCTGGGCCAGCGG - Intergenic
957630946 3:82715457-82715479 GGGCTTAGCACCTGGGCTAGCGG + Intergenic
957804909 3:85134092-85134114 GGGCTTAGCACCTGGGCCAGCGG - Intronic
957830019 3:85504907-85504929 GGGCTTAGCACCCGGGCCAGCGG - Intronic
957921817 3:86757726-86757748 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
957995099 3:87679227-87679249 GGACTTAGCACCCGGTCCAGTGG + Intergenic
958022632 3:88015818-88015840 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
959422736 3:106148756-106148778 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
960149806 3:114238521-114238543 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
960227538 3:115185118-115185140 GGGCTTAGCACCTGGGCCAGCGG - Intergenic
960341366 3:116479012-116479034 GGGACTTGCACCCAGGCCACAGG - Intronic
960685305 3:120288525-120288547 GTGCTTTGGACCCAAGCCAGGGG - Intergenic
960761676 3:121078785-121078807 GGGCTTAGCACCTGGGCCAGCGG - Intronic
961404539 3:126668852-126668874 GGGCCCAGGACCCAGGCCCGAGG + Intergenic
961460460 3:127046806-127046828 GGACTTAGCACCCGGGCCAGTGG + Intergenic
961565495 3:127760646-127760668 GGGCACAGCCCCCAGGCGAGTGG - Intronic
961688798 3:128653528-128653550 GGGCTTAGCACCCCGGCCAGCGG + Intronic
961811231 3:129523074-129523096 GGGGTAAGCACCCTGCCCAGTGG - Intergenic
962283753 3:134070492-134070514 GGACTTAGCACCCGGGCCAGTGG - Intronic
962338363 3:134559247-134559269 GGGCTTAGCACCCTAGACATGGG - Exonic
962398753 3:135039660-135039682 GGACTTAGCAGCCGGGCCAGTGG - Intronic
962600505 3:136987819-136987841 GGGCTTAGCACCCGGGCCAGCGG - Intronic
962758249 3:138484778-138484800 GGGCTTAGCACCTGGGCCAGTGG + Intergenic
963397209 3:144749941-144749963 GGACTTAGCACCCGGGCCAGCGG + Intergenic
963440401 3:145333507-145333529 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
963509154 3:146225663-146225685 GGACTTAGCTCCTGGGCCAGTGG - Intronic
963651829 3:147989612-147989634 GGGCTTAGCACGCGGGCCAGCGG - Intergenic
963862168 3:150323097-150323119 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
964014377 3:151928284-151928306 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
964032317 3:152152545-152152567 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
964037540 3:152217431-152217453 GGGCTTAGCATCTGGGCCAGCGG + Intergenic
964081840 3:152768311-152768333 GGGCTTAGTACCCAGACTACAGG + Intergenic
964117975 3:153155958-153155980 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
964139219 3:153378567-153378589 GGACTTAGCACCCGGGCTAGTGG - Intergenic
964444002 3:156740707-156740729 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
964452145 3:156822908-156822930 GGGCTTAGCACCCAGGCCAGTGG - Intergenic
964974170 3:162599827-162599849 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
964977758 3:162640199-162640221 GGGCTTAGCACCTGGGCCAGTGG + Intergenic
965040292 3:163499151-163499173 CGGCTTAGCACCTGGGCCAGCGG + Intergenic
965044137 3:163552553-163552575 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
965077991 3:164003097-164003119 GAGCTTAGCACCCAGGCCAGTGG + Intergenic
965200345 3:165649548-165649570 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
965220217 3:165918680-165918702 GGGCTTAGCACACCGGCCAGTGG - Intergenic
965220904 3:165924569-165924591 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
965245242 3:166258699-166258721 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
965298129 3:166975963-166975985 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
965753235 3:171999102-171999124 GGACTTAGCACCCGGGCCAGTGG - Intergenic
965837368 3:172866911-172866933 GGCTTTAGCACCCGGGCCAGCGG + Intergenic
966076065 3:175937502-175937524 GGACTTGGCACCTGGGCCAGCGG + Intergenic
966096792 3:176213651-176213673 GGGCTTAGCACCCAGGCCAGTGG - Intergenic
966191018 3:177271960-177271982 GGGCTTAGCATCCGGGCCAGCGG - Intergenic
966725001 3:183101026-183101048 GGACTTAGCACCCGGGCCAGTGG + Intronic
966725437 3:183103977-183103999 GGGCTTAGCACCCGGGCCAGCGG - Intronic
967718348 3:192789161-192789183 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
967918769 3:194599003-194599025 AGCCTTGGCAGCCAGGCCAGGGG + Intronic
968181599 3:196599268-196599290 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
968483494 4:847806-847828 GTGGGTAGCACTCAGGCCAGTGG + Intergenic
968577663 4:1375516-1375538 GGGCTCAGCACACAGGACACTGG - Intronic
968647649 4:1748475-1748497 GGGCTTAGTCCCCAGGCCTCCGG - Intergenic
968716159 4:2161398-2161420 GGGCTTAGCACCCAGGCCAGCGG + Intronic
968959137 4:3734159-3734181 GGGCTTCGAACCCAGGCCGCTGG - Intergenic
969362354 4:6672853-6672875 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
969440740 4:7215258-7215280 GGACTTAGCACCCGGGCCAGCGG + Intronic
969528335 4:7715520-7715542 GACCTTAGCTCCCAGGCCAAAGG + Intronic
969624756 4:8296777-8296799 GGGTTTACCCCCCAGGCCAGAGG - Intronic
969654977 4:8491641-8491663 GGACTTGGCACCCGGGCCAGCGG - Intronic
970182590 4:13415523-13415545 GAGCTTAGCACCCAGGCCAGTGG + Intronic
970391214 4:15615043-15615065 GGACTTAGCACCCGGGCCAGTGG + Intronic
970649328 4:18159500-18159522 GGAGTTAGCACCCGGGCCAGCGG - Intergenic
970673169 4:18418569-18418591 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
970803526 4:20004141-20004163 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
970808705 4:20065640-20065662 GGCCTGAGCACCCAGGTGAGGGG + Intergenic
971377115 4:26064210-26064232 GGGCTTAGTACCTGGGCCAGCGG - Intergenic
971553041 4:27978566-27978588 GGACTTAGCACCCGGGCCAGTGG - Intergenic
971563563 4:28112909-28112931 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
971639822 4:29117483-29117505 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
971709463 4:30092836-30092858 GGGCTTAGCATCCGGGCCAGCGG + Intergenic
971811954 4:31438781-31438803 GGACTTAGCACCCGGGCCAGTGG + Intergenic
971852094 4:31996518-31996540 GGGCTTAGCAGCCGGGCCAGCGG + Intergenic
971905197 4:32716456-32716478 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
972392548 4:38627032-38627054 GGGCTTAGCACCCGAGCCAGTGG + Intergenic
972772502 4:42210618-42210640 TGGCTTAGCAACATGGCCAGGGG + Intergenic
972900128 4:43672487-43672509 GGACTTAGCACCGGGGCCAGTGG + Intergenic
973190315 4:47378283-47378305 GGGCTTAGCACCTAGGCCAGCGG - Intronic
973308078 4:48675470-48675492 GGACTTAGCACCCGGGCCAGCGG + Intronic
973765094 4:54155355-54155377 GGGCTTAGCACCTGGGCCAGTGG - Intronic
973817579 4:54632666-54632688 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
974484790 4:62492127-62492149 GGACTTAGCACCCGGGCCAGCGG - Intergenic
974590598 4:63943105-63943127 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
974641745 4:64640704-64640726 GGACTTAGCACCCGGGCCAGTGG - Intergenic
974792770 4:66712645-66712667 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
974804384 4:66860298-66860320 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
974827757 4:67152009-67152031 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
974992875 4:69115475-69115497 GGGCTTAGCACCCGGGCCAGCGG - Intronic
975055401 4:69924020-69924042 GGGCTTAGCACCCGGACCAGCGG + Intergenic
975358646 4:73440151-73440173 GGGCTTAATACCCAGGCAACAGG - Intronic
975439956 4:74399295-74399317 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
975898432 4:79122062-79122084 GAGCTTAGCACCTGGGCCAGTGG + Intergenic
975978448 4:80126581-80126603 GGGCTTTGAACCCAGGCCCGGGG - Intergenic
976406376 4:84664820-84664842 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
976520630 4:86021838-86021860 GGACTTAGCACCCGGGCCAGTGG - Intronic
976980296 4:91218200-91218222 GGACTTAGCACCCGGGCCAGTGG - Intronic
977717349 4:100196751-100196773 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
977750967 4:100608996-100609018 GGACTTAGCACCCGAGCCAGTGG - Intronic
978080249 4:104582111-104582133 GGGCTTAGCACCCGGCCCAGCGG + Intergenic
978241887 4:106525576-106525598 AGGGTTAGCACCCGGGCCAGCGG - Intergenic
978998048 4:115179649-115179671 GGGCTTAACACCCAGGCCAGCGG - Intergenic
978999578 4:115200425-115200447 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
979290821 4:118977281-118977303 GGACTTAGCACCCAGGCCAGTGG - Intronic
979308318 4:119173915-119173937 GGACTTAGCACTCGGGCCAGCGG + Intronic
979424752 4:120550968-120550990 AGACTTAGCACCCGGGCCAGTGG - Intergenic
979609012 4:122670345-122670367 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
979688587 4:123538046-123538068 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
979825705 4:125229809-125229831 CGGCTTAGCACCCGGGCCAGCGG - Intergenic
979991463 4:127380064-127380086 GGACTTAGCACCCAGGCCAGTGG + Intergenic
980043381 4:127964468-127964490 GGGCTTAGCACCCGGGCCAGCGG - Intronic
980051932 4:128047789-128047811 GGACTTGGCACCCGGGCCAGCGG - Intergenic
980098037 4:128513118-128513140 GGGCTCAGAAGCCAGGCCATTGG - Intergenic
980227978 4:130012910-130012932 GGACTTAGCACCCGGGCCAGCGG + Intergenic
980274590 4:130633213-130633235 GGGTGTAGTTCCCAGGCCAGTGG - Intergenic
980470230 4:133240639-133240661 GGACTTAACACCCGGGCCAGTGG - Intergenic
980628592 4:135406748-135406770 GGACTTAGCACCCGGGTCAGTGG + Intergenic
980799758 4:137733865-137733887 GGGCTTAGCATCCGGGCCAGCGG + Intergenic
981146725 4:141333249-141333271 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
981176589 4:141690089-141690111 GGACTTAGCACCGGGGCCAGCGG - Intronic
982118017 4:152113924-152113946 GGTCTTAGCACCAAGGGCACAGG - Intergenic
982408224 4:155044432-155044454 GGACTTAGCACCCGGGTTAGTGG + Intergenic
982600650 4:157444195-157444217 GGGCTAAGGTCCCAGGCTAGTGG + Intergenic
982679096 4:158408195-158408217 GGGCTTAGCACCCGGGCCAGCGG + Intronic
982863380 4:160481889-160481911 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
982868807 4:160550339-160550361 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
982921270 4:161277380-161277402 CGGCTTAGCACACGGGCCACCGG + Intergenic
983026097 4:162739670-162739692 TAACTTAGCACCCGGGCCAGCGG + Intergenic
983230658 4:165126168-165126190 GGGCTTAGCATTCGGGCCAGCGG - Intronic
983553057 4:169036066-169036088 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
983733101 4:171022479-171022501 GGGCTTAATACCTAGGCAAGGGG + Intergenic
984192839 4:176625396-176625418 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
984238821 4:177193427-177193449 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
984265655 4:177495721-177495743 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
984662246 4:182386680-182386702 GGGCTTAGCACCCAGGCCAGCGG + Intronic
984770563 4:183433274-183433296 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
984776113 4:183482923-183482945 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
984948722 4:184990319-184990341 GGACTTAGCACCCGGGCCAAGGG - Intergenic
984961089 4:185099500-185099522 CGGCTCAGCCCCCAGGCCTGGGG - Intergenic
985087098 4:186324713-186324735 GGGCTTAGCATCCAGGCCAGTGG + Intergenic
985168926 4:187127636-187127658 GGGCTTTGCTCCCAGGCCATGGG + Intergenic
985195174 4:187421175-187421197 GGACTTAGCACCCGGGCCAGTGG - Intergenic
985203249 4:187505760-187505782 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
985366400 4:189236437-189236459 GGGCTTAGCACCCGGGCCAGAGG + Intergenic
985403874 4:189616877-189616899 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
986152000 5:5137915-5137937 GGACTTAGCACCTGGGCCAGTGG + Intergenic
986169151 5:5301827-5301849 GTGCTGAGAACCCAGGACAGGGG - Intronic
986697993 5:10375286-10375308 AGACTTGGCACCCGGGCCAGCGG + Intronic
986729456 5:10624517-10624539 GGGATCAGAGCCCAGGCCAGAGG - Intronic
986912387 5:12574175-12574197 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
987156790 5:15096786-15096808 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
987283730 5:16436312-16436334 GGGCTTAGCACCGGGGCCAGCGG + Intergenic
987315295 5:16718081-16718103 GGACTTAGCACCTGGGCCAGTGG + Intronic
987358221 5:17083580-17083602 GGGCTTAGCACCCGGGCCAGCGG + Intronic
987384012 5:17312003-17312025 GGACTTGGCACCCGGGCCAGTGG - Intergenic
987476697 5:18399903-18399925 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
987532784 5:19143001-19143023 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
987543829 5:19287874-19287896 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
987876948 5:23691254-23691276 GGACTTAGCACCCGGGCCAGTGG + Intergenic
988073501 5:26324590-26324612 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
988132159 5:27120028-27120050 GGACTTAACACCCGGGCCAGTGG + Intronic
988155055 5:27439681-27439703 GGACTTAGCAGCCGGGCCAGTGG - Intergenic
988177264 5:27743591-27743613 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
988279556 5:29127853-29127875 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
988369238 5:30345857-30345879 GGGCTTAGCACCCTGGCCAGCGG + Intergenic
988684736 5:33515617-33515639 GGACTTAGCACCCAGGCCAGCGG - Intergenic
988883588 5:35531756-35531778 GGTCTTAGCACCCGGGCCAGCGG + Intergenic
988915896 5:35893098-35893120 GGACTTAGCACCCGGGCCAGTGG - Intergenic
989346795 5:40438789-40438811 GGACTTAGCACCCGGGCCAGTGG + Intergenic
989956845 5:50369568-50369590 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
989965827 5:50465144-50465166 GGACTTAGCACCTGGGTCAGTGG + Intergenic
990345264 5:54865206-54865228 GGGCTTAGCACCCGGGCCGGCGG + Intergenic
990461523 5:56035619-56035641 GGACTTAGCACCCGGGCCAGTGG + Intergenic
991567566 5:68020633-68020655 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
992296738 5:75333815-75333837 GGACTTAGCACCCAGGCCAGTGG + Intergenic
992947445 5:81823852-81823874 AGACTTAGCACCCGGGCCAGCGG + Intergenic
993320936 5:86466912-86466934 GGACTTAGCACCCAGGCCAGTGG - Intergenic
993328580 5:86569754-86569776 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
993529192 5:89003850-89003872 GGGCTTAGCACCCAGACCAGCGG - Intergenic
993822035 5:92631461-92631483 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
994096340 5:95851297-95851319 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
994229966 5:97301278-97301300 GGGCTTAGCACCCAGGGCAGCGG + Intergenic
994507108 5:100656892-100656914 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
994605602 5:101962676-101962698 GGACTTAGCACCCGGGCCAGTGG - Intergenic
994701702 5:103142265-103142287 GGACTTAGCACCCGGGCCAGTGG - Intronic
994841091 5:104926025-104926047 GGGCTTAATACCCAGGTAAGGGG - Intergenic
994841390 5:104929133-104929155 GGCCTTAGCACCCGGACCAGCGG + Intergenic
995032320 5:107494373-107494395 GGGCTTAGCACCCAGGCCAGCGG + Intronic
995568675 5:113457274-113457296 GGACTTAGCACCCGGGCCAGCGG + Intronic
995596455 5:113753349-113753371 GGACTTAGCACCCTGGCCAGTGG - Intergenic
995656507 5:114432810-114432832 GGGCTTAGCACCTGGGCCAGCGG + Intronic
995679870 5:114704519-114704541 GGACTTAGCACCCGGGCCAGTGG - Intergenic
995920398 5:117304791-117304813 GGACTTAGCACCCGGGCCAGTGG + Intergenic
996107045 5:119517234-119517256 GGGCTTAGCACCCAGGCCAGCGG + Intronic
996234221 5:121107307-121107329 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
996435691 5:123430677-123430699 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
997521718 5:134527539-134527561 GGGCTTAACACCCAGGTCGGGGG - Intronic
997760560 5:136444343-136444365 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
999406181 5:151309322-151309344 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
999717113 5:154370234-154370256 GTGCCTAGCACCCAAGCCAGAGG - Intronic
999855284 5:155586982-155587004 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1000108815 5:158087622-158087644 GGGCTTAACACCTAGGTGAGGGG - Intergenic
1000329191 5:160194127-160194149 GGACTTAGCACCTGGGCCAGCGG - Intronic
1000891820 5:166810426-166810448 GAGCTTAGCACCTGGGCCAGTGG - Intergenic
1001271381 5:170314796-170314818 AGGCTTAGCCACCAGGGCAGAGG + Intergenic
1002004637 5:176222255-176222277 GGACTTAGCACCCGCGCCAGCGG - Intergenic
1002221742 5:177688365-177688387 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1002789377 6:426431-426453 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1002843643 6:926906-926928 AGGCTTAGAACCCAGGCAGGCGG + Intergenic
1003060723 6:2860270-2860292 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1003070222 6:2939760-2939782 GGGTTTAGCACCCGGGCCAGTGG + Intergenic
1003081912 6:3027831-3027853 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1003100191 6:3170896-3170918 GGGCTTAGCACCAGGGCCAGCGG + Intergenic
1003170848 6:3720995-3721017 GGACTTAGCACCCGGGCTAGTGG - Intergenic
1003508841 6:6762711-6762733 GAGCTTAGCACCTGGGCCAGCGG - Intergenic
1003531375 6:6940222-6940244 AGGCTTAGTACCCGGGGCAGCGG + Intergenic
1003581444 6:7344346-7344368 GGGTTTAGCACCCGGGCCAGCGG + Intronic
1003671539 6:8164463-8164485 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
1003717699 6:8666099-8666121 GGACTTAGCACCTGGGCCAGTGG + Intergenic
1003736895 6:8887296-8887318 GGACTTAGCACTCGGGCCAGTGG + Intergenic
1003748007 6:9024396-9024418 GGGATTAGCACCCGGGCCAGCGG + Intergenic
1003770157 6:9290670-9290692 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
1003845727 6:10171854-10171876 GAACTTAGCACCCGGGCCAGCGG + Intronic
1003862790 6:10337541-10337563 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1003908128 6:10720719-10720741 GGGCTTGGCACCCAGGCCAGCGG + Intergenic
1003956677 6:11171195-11171217 GGGCTCAGCACCCGGGCCAGCGG + Intergenic
1004036967 6:11933211-11933233 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
1004053152 6:12108620-12108642 GGGCTTAGCACCCAGGCCAGCGG - Intronic
1004196585 6:13511265-13511287 GGGTTTAGCACCTGGGCCAGCGG - Intergenic
1004200264 6:13541671-13541693 GTGCTTAGCACCCGGGCCAGCGG + Intergenic
1004224395 6:13772619-13772641 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
1004233708 6:13854946-13854968 AGACTTGGCACCCAGGCCAACGG - Intergenic
1004235544 6:13872152-13872174 GAGCTTAGCACCCAGGCCAGCGG - Intergenic
1004501892 6:16216950-16216972 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1004665529 6:17745537-17745559 TGACTTAGCACCCGGACCAGCGG - Intergenic
1004689093 6:17976418-17976440 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1004866054 6:19854657-19854679 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1004906934 6:20245001-20245023 GGACTTAGCACCCGGGCCGGTGG - Intergenic
1004912631 6:20301382-20301404 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1004964861 6:20836916-20836938 GGCCTTAGCACACAGTCCACTGG - Intronic
1005035571 6:21552514-21552536 GAACTTAGCACCCGGGCCAGTGG - Intergenic
1005059284 6:21761288-21761310 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1005332880 6:24766166-24766188 GGACTTAGCACCCGGGCCATTGG - Intergenic
1005471590 6:26166552-26166574 GGGGTTTACTCCCAGGCCAGGGG + Intronic
1005596212 6:27381298-27381320 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1005600871 6:27425058-27425080 GGGCTTGGCACCTGGGCCAGCGG - Intergenic
1005707445 6:28469583-28469605 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1005746092 6:28838970-28838992 GGGCTCAGCACCCCGGCCCCCGG - Intergenic
1005749930 6:28872823-28872845 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1005759806 6:28957975-28957997 GAACTTAGCACCTGGGCCAGTGG + Intergenic
1005977005 6:30807672-30807694 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1005978239 6:30816528-30816550 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1006008303 6:31020850-31020872 GGGCTTAGCACCCGGGCCAGTGG + Intronic
1006227065 6:32548154-32548176 GGACTTAGCACCTGGGCCAGTGG - Intergenic
1006352640 6:33532520-33532542 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1006477832 6:34269156-34269178 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1006696010 6:35931400-35931422 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
1006748901 6:36364462-36364484 GGACTTAGCACCCGGGCCAGCGG - Intronic
1006996617 6:38267129-38267151 GGGCTTAGCTCCCAGGCATCAGG + Intronic
1007636133 6:43300921-43300943 GGCCATTGCACCCAGCCCAGAGG + Intronic
1008005593 6:46405997-46406019 GGACTTAGCACCCGGGCCAGTGG - Intronic
1008038783 6:46774729-46774751 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1008270192 6:49482054-49482076 GGGCTTAGCACCCAAGCCAGCGG - Intronic
1008270495 6:49483647-49483669 GGGCTTAGCACCCAAGCCAGCGG - Intronic
1008284345 6:49629779-49629801 GGACTTAGCACCAGGGCCAGCGG - Intronic
1008770995 6:54979366-54979388 GGACATGGCACCCTGGCCAGTGG + Intergenic
1009587650 6:65627672-65627694 GGACTTAGCACCCGGGCCAGTGG + Intronic
1009685337 6:66949345-66949367 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
1010199313 6:73269104-73269126 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1010235649 6:73572766-73572788 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1010617385 6:78029933-78029955 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1011143692 6:84189498-84189520 GGACTTAGCACCCGGGCCAGTGG + Intronic
1011246520 6:85326099-85326121 GGGCCTAGCACCCGGGCCAGCGG + Intergenic
1012760501 6:103294634-103294656 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1013025720 6:106269636-106269658 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1013080226 6:106805886-106805908 GCGCTTAGCACCCGGGCCAACGG + Intergenic
1013081485 6:106816992-106817014 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1013119112 6:107125773-107125795 GGGCTAAACAACCAGGTCAGTGG + Intergenic
1013143567 6:107364475-107364497 GGACTTAGCACCCGGGCCAGTGG - Intronic
1013955343 6:115834830-115834852 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1014055886 6:117014885-117014907 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1014240742 6:119015454-119015476 GGGCTTAGCACCCGGGCCAGCGG + Intronic
1014507760 6:122280711-122280733 GGGCTTAGCACCCGGGCCAAAGG + Intergenic
1014731650 6:125038926-125038948 GGGCTTAGTACCCAGGTGATGGG - Intronic
1014738999 6:125125987-125126009 GGCTTTAGCACCCGGGCCAGCGG + Intronic
1014788469 6:125644582-125644604 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1014797984 6:125748125-125748147 GGGCTTAGCACGCTGGCCGCAGG + Intronic
1014921073 6:127214820-127214842 GGGCTTAGCACCTGGGCCAGCGG - Intergenic
1015284836 6:131474285-131474307 GGGCTTAATACCCAGGTGAGGGG + Intergenic
1015572253 6:134633775-134633797 GGGCTTAGCACCCTGGCCAGTGG - Intergenic
1015600344 6:134904861-134904883 GAACTTAGCACCCAGGCCAGCGG + Intergenic
1015935418 6:138403342-138403364 GGCCTCAGCACCCTGGCTAGGGG + Intergenic
1016067371 6:139698145-139698167 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1016069891 6:139726578-139726600 GGACTTAGCACCCGAGCCAGTGG - Intergenic
1016092833 6:139999814-139999836 GGACTTAGCACCCAGGCCAGCGG - Intergenic
1016217197 6:141618342-141618364 GGGCTTAGCACCTGGGCAAGCGG + Intergenic
1017298983 6:152834474-152834496 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1017325087 6:153133752-153133774 GGGTTTAGCACCCGGGCCAGCGG + Intergenic
1017537370 6:155363199-155363221 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1017581221 6:155866985-155867007 GGGCTTAGCAACCGGGCCAGCGG - Intergenic
1017821314 6:158050868-158050890 GGTGTCATCACCCAGGCCAGGGG + Intronic
1017839509 6:158210018-158210040 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1018545671 6:164933428-164933450 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1018624647 6:165765516-165765538 GGACTTAGCACCCGGGCCAGCGG - Intronic
1018696198 6:166393582-166393604 AGGCTTAGCACCCGGGCCAGCGG - Intergenic
1019000265 6:168744015-168744037 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1019944270 7:4314168-4314190 GGACTTAGTACCCGGGCCAGTGG - Intergenic
1019965754 7:4497160-4497182 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1021324123 7:19245614-19245636 GGACTTAGCACCGGGGCCAGTGG + Intergenic
1021686768 7:23193963-23193985 AAGCTTAGCACCCGGGCCAGCGG - Intronic
1023127935 7:36973868-36973890 GGGCTTAGCACCCGGGCCAGCGG + Intronic
1023873915 7:44276712-44276734 GGGCTCACCTCCCAGGCCCGAGG - Intronic
1023959398 7:44913983-44914005 GGGCTTGGGAGCCATGCCAGAGG - Intergenic
1024269077 7:47628607-47628629 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1024335638 7:48203143-48203165 GGACTTAGCACCCGGGCCAGCGG - Intronic
1024465903 7:49711383-49711405 GGGCTTAGCAACCGGGCCAGTGG + Intergenic
1024691277 7:51805965-51805987 GGGTGTAGCACCTGGGCCAGCGG + Intergenic
1024700638 7:51901125-51901147 GGGCTTAGCACCCAAGCCAGCGG - Intergenic
1024727814 7:52219657-52219679 GGGCTTAAAACCCAGGCAACAGG - Intergenic
1024825424 7:53385391-53385413 GGACTTAGCACCAGGGCCAGTGG - Intergenic
1024834045 7:53495151-53495173 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1025962073 7:66231570-66231592 GGGCTTAGCACCCAGGCTAGCGG - Intronic
1026187090 7:68090644-68090666 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1026202946 7:68231161-68231183 GGACTTGGCACCCGGGCCAGCGG + Intergenic
1026335895 7:69393957-69393979 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1026512340 7:71037724-71037746 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1026596559 7:71738309-71738331 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1027303421 7:76866492-76866514 GTGCTTAGCACACATGCTAGGGG - Intergenic
1027561668 7:79739430-79739452 GGGCTTAGCACCCGGGCAAGTGG + Intergenic
1027564040 7:79768194-79768216 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1027579715 7:79977833-79977855 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1027665890 7:81042838-81042860 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1027667534 7:81057713-81057735 GGACTTAGCACCTGGGCCAGCGG - Intergenic
1027674469 7:81141868-81141890 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1027868097 7:83673448-83673470 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1028070098 7:86440697-86440719 GGGCTTAGCTCCGGGGACAGTGG + Intergenic
1028157586 7:87449194-87449216 GGGCTTCCCACCCAGGCCTCTGG - Intronic
1028511222 7:91627623-91627645 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1028778323 7:94705623-94705645 GGGCTTAGCACCCGGGTCAGCGG + Intergenic
1028852519 7:95552693-95552715 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1029690755 7:102179788-102179810 GGGCTTCAGCCCCAGGCCAGGGG + Intronic
1029832375 7:103275155-103275177 GGACTTAGCACCTGGGCCAGTGG - Intergenic
1029988162 7:104940284-104940306 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1030102123 7:105955996-105956018 CGGCTTAGCACCTGGGCCAGCGG - Intronic
1030599983 7:111582173-111582195 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1030733479 7:113017473-113017495 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1030780413 7:113593449-113593471 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1030819314 7:114077073-114077095 GGGCTTAGCACTCAGGTCAGCGG - Intergenic
1031292260 7:119951741-119951763 GGACTTAGCACCCAGGCCAGTGG - Intergenic
1031378797 7:121060099-121060121 GGGCTTAGCACCCGGGCCAGCGG + Intronic
1031999371 7:128254745-128254767 GGCCTCAGCACCCAGGGCTGAGG - Exonic
1032248070 7:130230152-130230174 AGACTTAGCACCTGGGCCAGTGG + Intergenic
1032533263 7:132639125-132639147 GAGCTTATAACCCAGGCCAGTGG + Intronic
1032561605 7:132898837-132898859 GGGCTTAGCACCTGGGCCAGTGG - Intronic
1033233812 7:139622647-139622669 TGGCTCAGCTCCCAGGGCAGGGG + Intronic
1033664105 7:143424627-143424649 GGGCTTAGCACCCGCGCCAGCGG - Intergenic
1034091041 7:148363938-148363960 GGACTTAGCACCCGGGCCAGTGG + Intronic
1034167760 7:149038928-149038950 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1034529008 7:151683962-151683984 GGGTGTAGGAGCCAGGCCAGAGG - Intronic
1034632148 7:152539118-152539140 GGGCTTAGCACCCGGGTCAGCGG - Intergenic
1034656043 7:152730506-152730528 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
1034982059 7:155485381-155485403 TTGCTTTGTACCCAGGCCAGTGG + Intronic
1035056217 7:156038533-156038555 GGGCTCAGCACCAAGGGCAGAGG - Intergenic
1035151187 7:156874234-156874256 GGACTTAGCACCCAGGCCAGTGG - Intronic
1035999240 8:4582957-4582979 GGACATAGCACCCGGGCCAGTGG + Intronic
1036441033 8:8781622-8781644 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1036914977 8:12796425-12796447 GGGCCTAGCACCTGGGCCAGCGG + Intergenic
1037049481 8:14352615-14352637 GGGCTTGTTACCCAAGCCAGAGG - Intronic
1037263845 8:17037048-17037070 GGACTTAGCACCCGGGCCAGTGG - Intronic
1037425611 8:18751273-18751295 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1037881784 8:22577052-22577074 GGGAATGGCAACCAGGCCAGTGG - Intergenic
1037957555 8:23071016-23071038 GGGTTTAGCACCCGGGCCAGCGG - Intergenic
1037983523 8:23272246-23272268 GGACTTAGCACCTGGGCCAGCGG + Intronic
1037998288 8:23369010-23369032 GGGCTCAGCTCCCTTGCCAGTGG - Intronic
1038174070 8:25164626-25164648 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1038638276 8:29304383-29304405 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
1038639400 8:29311595-29311617 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
1038855206 8:31323741-31323763 GGGCTTAGTACCCAGGTAATGGG - Intergenic
1038870699 8:31489996-31490018 GAGCTTAGCACCCGGACCAGCGG + Intergenic
1039061303 8:33574033-33574055 GAACTTAGCACCCGGGCCAGTGG + Intergenic
1039069115 8:33634063-33634085 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1039284861 8:36028956-36028978 GGACTTAGCACCCAGGCCAGTGG + Intergenic
1039611503 8:38922940-38922962 GGGCTGAGCACAGAGGTCAGTGG - Intronic
1039620052 8:38988530-38988552 GGGCTTAACACCCAGGTGATGGG + Exonic
1039637298 8:39180244-39180266 GGGCTTAGCACCTGGGCCAGCGG + Intronic
1040026542 8:42786889-42786911 GGGCTTAGCACCCCAGCCAGTGG + Intronic
1040723120 8:50350045-50350067 GGGCTTAGCACCCTGGCCAGCGG + Intronic
1041657265 8:60366190-60366212 GGGCTTAGTACCCAGGTGATGGG - Intergenic
1041914526 8:63126239-63126261 GGGATTAGCACCCGGGCCAGCGG + Intergenic
1041918929 8:63162119-63162141 GGACTTAGCAGCCAGGCCAGTGG + Intergenic
1042512567 8:69626702-69626724 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1043073351 8:75665695-75665717 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1043129939 8:76447844-76447866 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1043352492 8:79377435-79377457 GGGCTTAGCACCCAGGCCAGTGG - Intergenic
1043435322 8:80231938-80231960 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1043642304 8:82470509-82470531 GGTCCTGGCACCCAGGCCAATGG + Intergenic
1043701124 8:83290482-83290504 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1043709879 8:83403072-83403094 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1044075818 8:87820964-87820986 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1044633477 8:94300564-94300586 GGACTTAGCACCTGGGCCAGCGG - Intergenic
1044788681 8:95823768-95823790 GGGCTTAGCACCCAGGCCAGCGG + Intergenic
1044880668 8:96719317-96719339 GAACTTAGCACCCAGGCCAGTGG - Intronic
1045131949 8:99163630-99163652 GGACTTAGCACCCCGGCCAGTGG - Intronic
1045232329 8:100317005-100317027 GGACTTAGCACCCGGGCCAGCGG - Intronic
1046149351 8:110202801-110202823 GGGCTTAGCACCTGGGCCAGCGG - Intergenic
1046208893 8:111041068-111041090 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1046265396 8:111823521-111823543 GGACTTAGTACCCGGGCCAGTGG - Intergenic
1046288902 8:112132821-112132843 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1046445335 8:114311480-114311502 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
1046450711 8:114386286-114386308 TGGCTTAGCACCTGAGCCAGCGG + Intergenic
1047631707 8:126714867-126714889 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1048676967 8:136794031-136794053 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1048757502 8:137755351-137755373 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1048789172 8:138084265-138084287 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1049087641 8:140490745-140490767 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1049257750 8:141622960-141622982 GGGCTGAGCACTGAGGCCACTGG + Intergenic
1049500310 8:142959606-142959628 GGACTTGGCACCCGGGCCAGCGG + Intergenic
1050920611 9:11196995-11197017 GGACTTAGCACCAGGGCCAGTGG + Intergenic
1051305092 9:15700272-15700294 GGGCTTAGCACCCGGGCCAGCGG - Intronic
1051383300 9:16480637-16480659 GGGTTTAGCACCCGGGCCAGCGG + Intronic
1051439854 9:17072734-17072756 GGGTTTAGCACCCGGGCCAGCGG + Intergenic
1051463796 9:17354064-17354086 GGACTTAGCACCCGGGCCAGTGG + Intronic
1051892692 9:21959380-21959402 GGACTTAGCACCCGGGCCAGTGG + Intronic
1052075443 9:24135198-24135220 GGGCTTAGCACCCGGGCCACCGG + Intergenic
1052128441 9:24809235-24809257 GGGCATAGCACACAGACCAGAGG - Intergenic
1052979544 9:34438054-34438076 GGGCTTAGCACCCGGGCCAGTGG + Intronic
1052985350 9:34482995-34483017 GGACTTAGCACCCGGGCCAGTGG - Intronic
1053006883 9:34610859-34610881 GGGCATGGAACCCAGGCCAGGGG + Exonic
1053027289 9:34740467-34740489 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1053547918 9:39042588-39042610 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1053812041 9:41862629-41862651 GGACTTAGCACCTGAGCCAGCGG - Intergenic
1054618554 9:67324810-67324832 GGACTTAGCACCTGAGCCAGCGG + Intergenic
1054722445 9:68617153-68617175 GGGCTCAGCACCCGGACCAGCGG + Intergenic
1055049356 9:71963668-71963690 GGGCTTAGCACCCAGGCCAGCGG + Intronic
1055248595 9:74276162-74276184 GGGCTTGGCACCCGGGCTGGCGG - Intergenic
1055446632 9:76390377-76390399 GAGCATGGCACCCAGCCCAGAGG - Intronic
1055557582 9:77490614-77490636 GGGCTTAGCACCCAGGCCAGTGG - Intronic
1055651373 9:78410126-78410148 GGGCTTAGCACCTGGGCCAAAGG + Intergenic
1056185097 9:84126516-84126538 GGGCTTAACACCTAGGTGAGAGG + Intergenic
1056185104 9:84126549-84126571 GGGCTTAACACCTAGGTGAGAGG + Intergenic
1056743745 9:89282555-89282577 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1056771398 9:89480649-89480671 GGACTTAGCACCCGGGCCAGTGG - Intronic
1057383924 9:94591375-94591397 GGACTTAGCACCCGGGCCAGTGG - Intronic
1057511131 9:95680460-95680482 GGGCTTAGCATCCAGCCCAGTGG + Intergenic
1057543864 9:96001950-96001972 GGACTTAGCACCCGGGCCAGTGG - Intronic
1057628635 9:96701119-96701141 GGACTCAGCACCCGGGCCAGTGG - Intergenic
1057726431 9:97571820-97571842 GTGCTCAGGCCCCAGGCCAGAGG - Intronic
1058174872 9:101724346-101724368 GGGCTTAGCACCCGGGCCAGAGG - Intronic
1058286559 9:103187032-103187054 GGGCTTAGCACCCCGGCCAGCGG + Intergenic
1058713003 9:107697344-107697366 GAGCCCATCACCCAGGCCAGGGG - Intergenic
1058824484 9:108762490-108762512 TGACTCAGCACCCAGGCCCGGGG + Intergenic
1059444110 9:114327641-114327663 GGGCTTGGGGCCCAGGCCAGAGG + Intergenic
1059445317 9:114334420-114334442 GGGCTTGGGGCCCAGGCCAGAGG + Exonic
1059793631 9:117667395-117667417 GGGCTTTGATCCCAGGTCAGTGG - Intergenic
1059810617 9:117852155-117852177 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1059991564 9:119870513-119870535 GGACTTAGCACCTGGGCCAGTGG - Intergenic
1060158831 9:121340889-121340911 CCCCTAAGCACCCAGGCCAGAGG - Exonic
1060171888 9:121468758-121468780 GGCCTTAGCACCCTTGCCAATGG - Intergenic
1060206930 9:121687571-121687593 GGGATTCGAACCCAGGCCAGTGG - Intronic
1060912263 9:127360624-127360646 CAGCTCAGCACCCAGGGCAGTGG + Intronic
1060967396 9:127719418-127719440 GGGCTCAGCACCCAGGGCCCAGG + Intronic
1061047701 9:128176039-128176061 GGGGTTAGCACACATGCCACAGG + Intronic
1061483823 9:130910251-130910273 GAACTTAGCACCTGGGCCAGCGG + Intronic
1061485780 9:130919896-130919918 GGGCTTGGCAGTCAGGCCTGGGG + Intronic
1062277040 9:135736157-135736179 GGGTGTAGTACCCTGGCCAGGGG - Intronic
1186152599 X:6690738-6690760 GGGCTTAGCGCCCGGGCCAGCGG - Intergenic
1186323257 X:8452722-8452744 GGACTTAGCACCCGGGCCACTGG - Intergenic
1186878289 X:13838827-13838849 GAGCTGAGCACCTAGGCCTGAGG - Intronic
1187005846 X:15231962-15231984 GGGCTTAGCACCCGGGCCAGTGG - Intergenic
1187139044 X:16575582-16575604 GGGCTTAGCACCCGGGCCAGCGG + Intergenic
1187304604 X:18083932-18083954 GGACTTAGCACCCGGGCCAGTGG + Intergenic
1187557577 X:20367081-20367103 GGACTTGGCACCCGGGCCAGTGG - Intergenic
1188189525 X:27157133-27157155 GGACTTGGCACCCGGGCCAGCGG + Intergenic
1188727368 X:33602449-33602471 GGGCTTAGCACCTAGGTGATGGG - Intergenic
1189184872 X:39045795-39045817 GGATTTAAAACCCAGGCCAGGGG - Intergenic
1190045874 X:47111235-47111257 GGGCTTAGCACCCGGGCTAGTGG - Intergenic
1190413971 X:50163562-50163584 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1190877562 X:54470632-54470654 GGGCCTGGCTCCCAGGGCAGAGG - Exonic
1191169270 X:57424284-57424306 GAGCATAGAACCCAGGCCACTGG + Intronic
1191618640 X:63192803-63192825 GGGCTTAGTACCTGGGCCAGCGG - Intergenic
1192199880 X:69060158-69060180 AGGCTTAGCAGGCAGGCGAGCGG + Intergenic
1192869663 X:75173829-75173851 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1192870570 X:75179749-75179771 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1192963710 X:76155506-76155528 GGGCTTAACACCTAGACAAGGGG + Intergenic
1193804047 X:85972589-85972611 GGGCTTAGCACCCGGGCCAGTGG - Intronic
1194071602 X:89331261-89331283 GGACTTAGCACCTGGGCCAGTGG - Intergenic
1194121210 X:89965878-89965900 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1194166340 X:90521464-90521486 GAACTTAGCACCCGGGCCAGTGG + Intergenic
1194418589 X:93644519-93644541 GGGCTTAATACCCAGGTCATGGG - Intergenic
1194556472 X:95367120-95367142 GGGCTGAACATCCAGGCCATGGG + Intergenic
1194650827 X:96512483-96512505 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1195258038 X:103107581-103107603 GGGCTTAGCACCCAGGCCAGTGG - Intergenic
1196319537 X:114270792-114270814 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1196662533 X:118282973-118282995 GGACTTAGCACCTGGGCCAGTGG - Intergenic
1196705918 X:118717168-118717190 GGGCTTAGCACCCAGGCCAGCGG - Intergenic
1196714609 X:118799085-118799107 GGACTTAGCACCCGGGCCAATGG + Intergenic
1196728938 X:118922215-118922237 CGACTTAGCACCGGGGCCAGTGG - Intergenic
1196741515 X:119029643-119029665 GGACTTAGCACCTGGGCCAGTGG + Intergenic
1196761978 X:119208704-119208726 GGACTTAGGACCCGGGCCAGTGG - Intergenic
1196762352 X:119211111-119211133 AGACTTAGCACCCGGGCCAGTGG - Intergenic
1196775197 X:119332003-119332025 GGACTTAGGACCCGGGCCAGTGG + Intergenic
1196775503 X:119333724-119333746 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
1196781471 X:119387816-119387838 AGACTTAGCACCCGGGCCAGTGG - Intergenic
1196793985 X:119488095-119488117 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1196827282 X:119751060-119751082 GGACTTAGCACCCAGGCCAGTGG - Intergenic
1196845056 X:119890720-119890742 GGGTTTAGCACCCGGGCCAGCGG + Intergenic
1197000294 X:121431760-121431782 GGGCTTAGCACTCGGGCCAGTGG - Intergenic
1197303163 X:124805765-124805787 AGGCTTAGGGACCAGGCCAGAGG + Intronic
1197331187 X:125155707-125155729 GGGCTTAGCACCTGGGCCAGTGG - Intergenic
1197340046 X:125255776-125255798 GGGCTTAGCACTCAGGCCAGCGG + Intergenic
1197344835 X:125319294-125319316 GGACTTAGCACCCCGGCCAGTGG - Intergenic
1197376807 X:125690812-125690834 GAGCTTAGCACCCGGGCCAGCGG - Intergenic
1197892552 X:131281031-131281053 GGGGTCAGCACTCAAGCCAGCGG - Intronic
1198299980 X:135325583-135325605 GGACGTAGCACCCGGGCCAGCGG + Intronic
1198664317 X:139004257-139004279 GGACTTATCACCCGGGCCAGTGG - Intronic
1198694443 X:139320931-139320953 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
1198807915 X:140507786-140507808 AGGCTTAGCCACCAGCCCAGCGG + Intergenic
1198972597 X:142298477-142298499 GTGCTTAGCACCCGGGCCAGCGG - Intergenic
1199009948 X:142745955-142745977 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1199028804 X:142972368-142972390 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1199050233 X:143228922-143228944 GGACTTAGCACCTGGGCCAGCGG - Intergenic
1199175533 X:144783761-144783783 GGACTTAGCACCCGGGCCAGCGG + Intergenic
1199356253 X:146867114-146867136 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1199831290 X:151551419-151551441 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1200423569 Y:2998607-2998629 GAACTTAGCACCCGGGCCAGTGG - Intergenic
1200474067 Y:3623329-3623351 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1200512608 Y:4099245-4099267 GAACTTAGCACCCGGGCCAGTGG + Intergenic
1200725840 Y:6666990-6667012 GGACTTAGCACCTGGGCCAGTGG - Intergenic
1200824303 Y:7622448-7622470 GGACTTAGCACCCGAGCCAGTGG - Intergenic
1201285487 Y:12375241-12375263 GGGCTTAGCACCCGGGCCAGCGG - Intergenic
1201423048 Y:13820437-13820459 GGACTTAGCACCCGGGCCAGCGG - Intergenic
1201479929 Y:14428219-14428241 GGACTTAGCACCGAGGCCAGTGG + Intergenic
1201487068 Y:14505779-14505801 GGACTTAGCACTCGGGCAAGCGG + Intergenic
1201495693 Y:14590015-14590037 GGACTTAGCACTCGGGCCAGTGG - Intronic
1201496938 Y:14598428-14598450 GGACTTAGCATCTGGGCCAGTGG - Intronic
1201573028 Y:15433973-15433995 GGGCTTAGCACCTGGGCCAGCGG + Intergenic
1201729029 Y:17185831-17185853 GGGCTTAACACCCAGGCCAGTGG - Intergenic
1201982627 Y:19923948-19923970 GGACTTAGCACCCGGGCCAGTGG - Intergenic
1202109834 Y:21407330-21407352 GGGCTTAGCACCCGGGCCAGTGG + Intergenic
1202137103 Y:21676895-21676917 GGGATTAGCACCCGAGCCAGCGG - Intergenic
1202235752 Y:22708639-22708661 GGACTTAGCACCCGAGCCAGTGG + Intergenic
1202307411 Y:23487529-23487551 GGACTTAGCACCCGAGCCAGTGG - Intergenic
1202563394 Y:26183057-26183079 GGACTTAGCACCCGAGCCAGTGG + Intergenic