ID: 1082698770

View in Genome Browser
Species Human (GRCh38)
Location 11:56402181-56402203
Sequence TGGCTGGCCCTGCTGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082698770_1082698777 -6 Left 1082698770 11:56402181-56402203 CCCAGGGCCAGCAGGGCCAGCCA No data
Right 1082698777 11:56402198-56402220 CAGCCAGCTGCTCCGAGTGGGGG No data
1082698770_1082698776 -7 Left 1082698770 11:56402181-56402203 CCCAGGGCCAGCAGGGCCAGCCA No data
Right 1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG 0: 11
1: 51
2: 254
3: 398
4: 649
1082698770_1082698773 -9 Left 1082698770 11:56402181-56402203 CCCAGGGCCAGCAGGGCCAGCCA No data
Right 1082698773 11:56402195-56402217 GGCCAGCCAGCTGCTCCGAGTGG No data
1082698770_1082698774 -8 Left 1082698770 11:56402181-56402203 CCCAGGGCCAGCAGGGCCAGCCA No data
Right 1082698774 11:56402196-56402218 GCCAGCCAGCTGCTCCGAGTGGG No data
1082698770_1082698778 -5 Left 1082698770 11:56402181-56402203 CCCAGGGCCAGCAGGGCCAGCCA No data
Right 1082698778 11:56402199-56402221 AGCCAGCTGCTCCGAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082698770 Original CRISPR TGGCTGGCCCTGCTGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr