ID: 1082698776

View in Genome Browser
Species Human (GRCh38)
Location 11:56402197-56402219
Sequence CCAGCCAGCTGCTCCGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1363
Summary {0: 11, 1: 51, 2: 254, 3: 398, 4: 649}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082698770_1082698776 -7 Left 1082698770 11:56402181-56402203 CCCAGGGCCAGCAGGGCCAGCCA No data
Right 1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG 0: 11
1: 51
2: 254
3: 398
4: 649
1082698771_1082698776 -8 Left 1082698771 11:56402182-56402204 CCAGGGCCAGCAGGGCCAGCCAG No data
Right 1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG 0: 11
1: 51
2: 254
3: 398
4: 649
1082698766_1082698776 2 Left 1082698766 11:56402172-56402194 CCCTTATTGCCCAGGGCCAGCAG No data
Right 1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG 0: 11
1: 51
2: 254
3: 398
4: 649
1082698761_1082698776 23 Left 1082698761 11:56402151-56402173 CCGCTGGCCTGGGTGCTAAGCCC 0: 54
1: 275
2: 367
3: 198
4: 260
Right 1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG 0: 11
1: 51
2: 254
3: 398
4: 649
1082698765_1082698776 3 Left 1082698765 11:56402171-56402193 CCCCTTATTGCCCAGGGCCAGCA No data
Right 1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG 0: 11
1: 51
2: 254
3: 398
4: 649
1082698767_1082698776 1 Left 1082698767 11:56402173-56402195 CCTTATTGCCCAGGGCCAGCAGG No data
Right 1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG 0: 11
1: 51
2: 254
3: 398
4: 649
1082698762_1082698776 16 Left 1082698762 11:56402158-56402180 CCTGGGTGCTAAGCCCCTTATTG No data
Right 1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG 0: 11
1: 51
2: 254
3: 398
4: 649
1082698760_1082698776 29 Left 1082698760 11:56402145-56402167 CCGCAGCCGCTGGCCTGGGTGCT No data
Right 1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG 0: 11
1: 51
2: 254
3: 398
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082698776 Original CRISPR CCAGCCAGCTGCTCCGAGTG GGG Intergenic
900113288 1:1018589-1018611 CCGGCCGGCTGCTCCAAGTGCGG + Intergenic
900165733 1:1243642-1243664 CGGGAGAGCTGCTCCGAGTGAGG - Intronic
900177173 1:1296009-1296031 ACAGCCAGCAGCTCCCGGTGAGG - Exonic
901094298 1:6665903-6665925 CCAGCCAGGTGCCCGGAGGGAGG - Intronic
901601490 1:10426637-10426659 CCAGCCGGCTGCTCCGAGTGCGG + Intergenic
901783328 1:11608840-11608862 CCGGCCTGCTGCTCCGAGTGCGG - Intergenic
901849426 1:12006299-12006321 CCTGGCAGCTTCCCCGAGTGTGG - Intronic
902033432 1:13439368-13439390 TCAGCCCGCGGCTCAGAGTGCGG - Intergenic
902410741 1:16210195-16210217 CCAGCCAGCTGGGCAGAGAGAGG - Intronic
902521914 1:17023284-17023306 TTTGCCAGCTGCTCCGAGTTGGG - Intronic
902599150 1:17529432-17529454 CAAGCCAGCTTCTCAGGGTGGGG + Intergenic
903603395 1:24557819-24557841 CCAGCCAGCCGCGGCGCGTGCGG + Intronic
903891789 1:26574651-26574673 ACAGCCAGATGCTCTGAGAGAGG - Intronic
904253562 1:29240676-29240698 CCTGCCAGCTGCTAGGGGTGGGG - Intronic
904694052 1:32317704-32317726 GCTGCCAGCTGCTGTGAGTGAGG + Intronic
905038124 1:34930213-34930235 CCTGCCAGCGGCTCCGAGGCCGG - Intergenic
905742877 1:40387935-40387957 CTGGCCGGCTGCTCCAAGTGCGG - Intronic
905761161 1:40559149-40559171 CCAGCCGGCCGCTTGGAGTGTGG + Intergenic
906185988 1:43862463-43862485 CAAGCCAGCTGCAAGGAGTGTGG - Intronic
906365546 1:45206480-45206502 CGAGCCAGCCGGCCCGAGTGGGG + Exonic
906877726 1:49556986-49557008 GCTGCTAGCTGCTCAGAGTGCGG + Intronic
907348792 1:53808072-53808094 TCACCCAGCTGCTCGTAGTGAGG - Intronic
907759512 1:57343684-57343706 CCGGCCGGCCGCTCCAAGTGTGG + Intronic
907761656 1:57367684-57367706 CCTGCCAGCTCCACGGAGTGTGG - Intronic
907889480 1:58623513-58623535 CCGGCCGGCTGCTCCCAGTGCGG - Intergenic
908027769 1:59969942-59969964 CCGGCCGGCTGCTCCAAGTGCGG + Intergenic
908291320 1:62669972-62669994 CTGGCTGGCTGCTCCGAGTGCGG - Intronic
908755415 1:67464996-67465018 CCAGCCTGGTGCTCCGGGTCTGG + Intergenic
908888576 1:68817803-68817825 CCGGCCGGCCGCTCCAAGTGCGG - Intergenic
909377089 1:74952325-74952347 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
909608746 1:77531998-77532020 CCGGCCGGCCGCTCCGAGTGCGG + Intronic
910034781 1:82777059-82777081 CCGGCTGGCTGCTCCGAGTGCGG + Intergenic
910685721 1:89914236-89914258 CTGGCCAACTGCTCCGAGTGCGG + Intronic
910693149 1:89984895-89984917 CCGGCTGGCGGCTCCGAGTGCGG + Intergenic
911001444 1:93170350-93170372 CCGGCCGGCCGCTCCCAGTGCGG - Intronic
911259615 1:95669905-95669927 CCGGCCGGCTGCTCCGAGTGTGG + Intergenic
911305249 1:96224616-96224638 CTGGCCGGCTGCTCTGAGTGCGG + Intergenic
911853932 1:102853858-102853880 CCAGCCGGCTGCTCCGAGTGCGG - Intergenic
911954507 1:104217722-104217744 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
912058139 1:105631513-105631535 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
912166135 1:107044838-107044860 CGGGCCGGCTGCTCGGAGTGCGG - Intergenic
912312894 1:108641138-108641160 CCAGCAGGCTGCTCCGAGGGCGG + Intronic
912315914 1:108667558-108667580 CCCGCCGGCTGCTCCGAGTGCGG - Intergenic
912538772 1:110396615-110396637 CGGGCCAGCCTCTCCGAGTGCGG + Intergenic
912807696 1:112770927-112770949 CCTGCCAGGAGCTCCGAGAGAGG + Intergenic
913161081 1:116146833-116146855 CCAGCTGGCTGCTCCGAGTGCGG + Intergenic
913262506 1:117012374-117012396 CCACCCAGCTGGTGAGAGTGGGG + Intronic
913470182 1:119179150-119179172 CCAGCTGGCTGCTCTGAGTGCGG - Intergenic
913692128 1:121289382-121289404 CTGGCTGGCTGCTCCGAGTGCGG + Intronic
914145428 1:144990732-144990754 CTGGCCGGCTGCTCCGAGTGCGG - Intronic
914438457 1:147681044-147681066 CCAGCCGGCTGCTCCGAGTGTGG + Intergenic
914675344 1:149903900-149903922 CCTGGCAGCTCCTCTGAGTGGGG - Exonic
915104113 1:153521869-153521891 CCTGCCGGCTGCTCCGAGTGTGG - Intergenic
915260037 1:154670833-154670855 CCGGCCGGCTGCTCCGAGTGTGG - Intergenic
915261207 1:154678120-154678142 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
916219849 1:162433236-162433258 CCGGCCGGCTGCTCCGAGTTCGG - Intergenic
916606055 1:166343310-166343332 CCAGCCGGCCCCTCCGAGTGCGG + Intergenic
916909890 1:169335848-169335870 CAAGCCAGCTGCTTCCAGTAAGG + Intronic
916940058 1:169668137-169668159 CCGGCCGGCCGCTCCGAGTGTGG - Intronic
916960266 1:169882194-169882216 CCTGCCGGCTGCTCCAAGTGGGG - Intronic
917197905 1:172485706-172485728 TCAGCCAGCTGGTCCAAGTTAGG + Intergenic
917284145 1:173407044-173407066 CCAGCAGTCTGCACCGAGTGAGG - Intergenic
917348879 1:174056650-174056672 CCCGCTGGCCGCTCCGAGTGTGG + Intergenic
917406325 1:174711480-174711502 CAGGCCAGCCGCTCCGAGTGCGG - Intronic
917445423 1:175102578-175102600 CTGGCCGGCTGCTCTGAGTGCGG + Intronic
917446378 1:175108735-175108757 CTGGCCGGCTGCTCTGAGTGCGG + Intronic
917578564 1:176349548-176349570 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
917933014 1:179837208-179837230 CCGCCCGGCTGCTCCGAGTGCGG + Intergenic
918154562 1:181832498-181832520 CTGGCCAGCTGCTCCGAATGCGG - Intergenic
918542717 1:185649205-185649227 CCGGCCAGCCACTCCGAGTGCGG + Intergenic
918659775 1:187074094-187074116 CTGGCCAGCTGCTTCGAGTGCGG + Intergenic
918726940 1:187937555-187937577 CCAGCCAGCTGAGCTGAGTCTGG - Intergenic
918789957 1:188813169-188813191 CCGGCCGGCAGCTCCGAGTGCGG - Intergenic
918792055 1:188841452-188841474 CCTGCCGGCTGCTCCCAGTGCGG + Intergenic
918942991 1:191026272-191026294 CCAGCTGGCCGCTCTGAGTGTGG + Intergenic
918993881 1:191731897-191731919 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
919091885 1:192986993-192987015 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
919167967 1:193919190-193919212 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
919297777 1:195723148-195723170 CTGGCCGGCCGCTCCGAGTGCGG + Intergenic
920479451 1:206307730-206307752 CTGGCCGGCTGCTCCGAGTGCGG + Intronic
920604881 1:207371675-207371697 CCAGCCGGCTGCTCTGAGTGTGG + Intergenic
920731385 1:208488716-208488738 CCGGCTGACTGCTCCGAGTGCGG + Intergenic
920878475 1:209858928-209858950 CCAGCCGGCCGCTGCAAGTGCGG + Intergenic
920882047 1:209889217-209889239 CCGGCCGGCCGTTCCGAGTGCGG + Intergenic
920883166 1:209899078-209899100 CTGGCTGGCTGCTCCGAGTGTGG + Intergenic
921094442 1:211874570-211874592 CCGGCCTGCTGTTCCGAGTGTGG + Intergenic
921396402 1:214673424-214673446 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
921801790 1:219410734-219410756 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
921897081 1:220412514-220412536 CCAGCCGGCCGCTCCGAGGGTGG - Intergenic
921903856 1:220475947-220475969 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
921983692 1:221285936-221285958 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
922056814 1:222049829-222049851 CCGGACTGCTGCTCCGAGTGCGG - Intergenic
922417062 1:225431448-225431470 CCGGCCAGCCGCTCCGAGTGCGG - Intergenic
922423194 1:225472789-225472811 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
922541928 1:226426570-226426592 CCAGCTGGCTGCTCCGAGTGCGG + Intergenic
922985861 1:229865539-229865561 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
923030794 1:230247690-230247712 ACAGCCAGGTGTTCCGTGTGGGG + Intronic
923157249 1:231289753-231289775 CCGGCCGGCTGCTCCGAGTGTGG + Intergenic
923172609 1:231431051-231431073 CCAGCCAGCCACTCCAAATGCGG + Intergenic
923193463 1:231642183-231642205 CCGGCCGGCCACTCCGAGTGCGG + Intronic
923534761 1:234840658-234840680 CCAGCCACCAGCCCAGAGTGGGG + Intergenic
923573795 1:235140367-235140389 CCGGCCGGCTGCTCCGAGTGCGG - Intronic
923810535 1:237309904-237309926 CCAGCCAGCCACTCCGAGTGCGG + Intronic
923930091 1:238684908-238684930 CCCGCCGGCTGCTCCGAGTGCGG + Intergenic
924117504 1:240762572-240762594 CCGGCCAGCTGCTCTGAGTGCGG - Intergenic
924219253 1:241855856-241855878 CCGGCCGGCTGCTCTGAGTGCGG + Intronic
924305929 1:242689510-242689532 CCGGCTGGCTGCTCAGAGTGTGG - Intergenic
1063148972 10:3320106-3320128 CCGGCCAGCCGCTCAGAGTGTGG + Intergenic
1063318748 10:5032796-5032818 CTGGCCGGCTGCTCAGAGTGCGG + Intronic
1063848690 10:10160979-10161001 CCGGCTGGCTGCTCCGAGTGTGG - Intergenic
1064197774 10:13259688-13259710 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1064475981 10:15689849-15689871 GCTGCCAGCTACTCAGAGTGTGG + Intronic
1065284808 10:24177002-24177024 CCAGCTGGCTGCTCCGAGTGCGG + Intronic
1065554888 10:26905628-26905650 CCGGCCAGCCAATCCGAGTGTGG - Intergenic
1065743296 10:28815951-28815973 CCGGCCGGCTGCTCGGAGTGCGG + Intergenic
1065895881 10:30162937-30162959 TCGGCCAGCAGCTCCGAGTGTGG - Intergenic
1065981581 10:30903076-30903098 CCAGCCAGCCGCTCCCAGTGCGG + Intronic
1065995486 10:31055905-31055927 CCGGCCAGCGGCTCCGAGTGAGG - Intergenic
1066186287 10:33013374-33013396 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1066190244 10:33049308-33049330 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1066234029 10:33468116-33468138 CTGGCCGGCTGCTCCGAGTGTGG - Intergenic
1066235480 10:33480742-33480764 AGGGCCGGCTGCTCCGAGTGCGG + Intergenic
1066247125 10:33594153-33594175 CCAGCCAGCATCCTCGAGTGTGG - Intergenic
1066296091 10:34055637-34055659 CCTGCTCGCAGCTCCGAGTGCGG - Intergenic
1066544259 10:36482276-36482298 CCAGCCGGCTGCTCCGAGTGTGG + Intergenic
1066567417 10:36734897-36734919 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1068128712 10:52871390-52871412 GAAGGCAGCTGCCCCGAGTGGGG - Intergenic
1068211316 10:53924264-53924286 CCAGCCGGCCGCTCTGAGTGCGG - Intronic
1068216655 10:53990894-53990916 CCAGACGGCCGCTCGGAGTGTGG - Intronic
1068374006 10:56155205-56155227 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1068554972 10:58448534-58448556 CTGGCCTGCTGCTCTGAGTGCGG + Intergenic
1068863154 10:61867727-61867749 CCGGCCGGCTGCTCCGAGTTTGG - Intergenic
1068902099 10:62280460-62280482 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
1069186540 10:65429695-65429717 CAGGCCAGCTGCTCCGAGTGTGG + Intergenic
1069215363 10:65812331-65812353 CCGGCCGGCTGCTCCGAGTCGGG + Intergenic
1069280855 10:66651741-66651763 CTGGCCTGCGGCTCCGAGTGCGG + Intronic
1069766125 10:70861726-70861748 CCGGCCGGCTGCTCCGAGTGCGG - Intronic
1069992953 10:72326037-72326059 CCGGCGGGCTGCTCCGAGTGCGG - Intergenic
1070172708 10:73944685-73944707 CCAGCCGGCCACTCAGAGTGCGG - Intergenic
1070872905 10:79773342-79773364 GCAGCTGGCTTCTCCGAGTGAGG + Intergenic
1070937879 10:80315513-80315535 CCGGCCTGCCGCTCCGAGTGCGG - Intergenic
1070942572 10:80359767-80359789 CTGGCCGGCTGATCCGAGTGCGG + Intronic
1071003740 10:80859318-80859340 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1071037498 10:81265192-81265214 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1071332167 10:84571281-84571303 CCAGCCAGCCGCTTGGAGTGCGG - Intergenic
1071387988 10:85141482-85141504 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1071639828 10:87295493-87295515 GCAGCTGGCTTCTCCGAGTGAGG + Intergenic
1071655406 10:87442459-87442481 GCAGCTGGCTTCTCCGAGTGAGG - Intergenic
1071901001 10:90120053-90120075 CCGGCTGGCCGCTCCGAGTGCGG + Intergenic
1071963795 10:90832454-90832476 CCAGCCGGCTGCTCCGAGTGCGG + Intronic
1072278482 10:93845274-93845296 CCTGCCGGCCGCTCCGAGTGTGG - Intergenic
1072341866 10:94459775-94459797 CCGGCCAGCAGCTCCAAGTGTGG + Intronic
1073789786 10:106928372-106928394 CCGGCAGGCTGCTCCGAGTGCGG + Intronic
1074999216 10:118782985-118783007 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1075255604 10:120923907-120923929 CCGGCCGGCTGCTCCAAGTGCGG - Intergenic
1075269394 10:121035617-121035639 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1075305708 10:121365659-121365681 CCCGCCGGCCGCTCCGAGCGTGG - Intergenic
1075661237 10:124197970-124197992 CCTGCCAGCTGTTCCGAATAAGG + Intergenic
1076035721 10:127196869-127196891 CCCGCCAGCTGCTCCGGAGGCGG - Intronic
1076261674 10:129071630-129071652 CCGGCCGGCTGCTCCGAGTGTGG + Intergenic
1076773598 10:132680744-132680766 CCGGCCGGCTGCTCGGAGTGCGG - Intronic
1076796549 10:132801214-132801236 CCGGCCGGCTGCTCGGAGTGCGG + Intergenic
1077603231 11:3588809-3588831 CCTGCCGGCAGCTCCTAGTGCGG - Intergenic
1077764576 11:5144497-5144519 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1077778222 11:5294676-5294698 CCGGCTGGCGGCTCCGAGTGCGG + Intronic
1077815603 11:5683030-5683052 CCGGCCGGCCACTCCGAGTGCGG - Intronic
1078619948 11:12898168-12898190 ATAACCAGCTGCTCAGAGTGTGG - Intronic
1078743709 11:14091605-14091627 CTGGCCGCCTGCTCCGAGTGCGG + Intronic
1079076141 11:17386575-17386597 CCAGCCACCGGCCCAGAGTGTGG + Exonic
1079708686 11:23653427-23653449 CCGGCCGGCTGCTCCCAGTGTGG + Intergenic
1079726235 11:23883709-23883731 CTGGCCGGCTGCTCCCAGTGCGG + Intergenic
1079731771 11:23942556-23942578 CCGGCCGGCTGCTCCTAGTGCGG + Intergenic
1079756820 11:24274518-24274540 CCGGCCGGTTGCTCTGAGTGCGG + Intergenic
1079803156 11:24896370-24896392 CCGGCTGGCTGCTCCAAGTGTGG - Intronic
1080195212 11:29600424-29600446 CTGGCCGGCTGCTCCAAGTGCGG + Intergenic
1080557708 11:33432021-33432043 CAGGCCGGCTGCTCCGAGTGCGG + Intergenic
1080621429 11:33990182-33990204 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1080649802 11:34213004-34213026 CCAGCCCGGTGTTCGGAGTGAGG - Intronic
1081106653 11:39078696-39078718 CTGGCCAGCTGCACCAAGTGCGG - Intergenic
1081115343 11:39192829-39192851 CCGGCCAGCAGCTCCGAGTGCGG + Intergenic
1081125046 11:39311911-39311933 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1081126952 11:39333346-39333368 CCAGCCGACCGCTCCCAGTGCGG + Intergenic
1081329726 11:41788504-41788526 CCGGCCAGCTGCTCCGAGTGTGG + Intergenic
1081428364 11:42949959-42949981 CCGGCTGGCTGCTCCGAGTGCGG - Intergenic
1081770336 11:45646445-45646467 CCAGCCAGGGGCACTGAGTGAGG + Intergenic
1082106717 11:48228992-48229014 CCAGCAGCCTGCTCCGAGTGCGG - Intergenic
1082272101 11:50183355-50183377 CCGGCTGGCTGCTCCGAGTGTGG - Intergenic
1082698776 11:56402197-56402219 CCAGCCAGCTGCTCCGAGTGGGG + Intergenic
1083074310 11:60020495-60020517 CCAGCCGGCGGCTCCGAGTGTGG + Intergenic
1083546096 11:63550288-63550310 CCGGCTGGCTGCTCCGAGTGCGG - Intergenic
1084024759 11:66441011-66441033 CCGGCCGGCCGCTCCGAGTGCGG + Intronic
1084107394 11:66988877-66988899 CTGGCCGGCTGCTCCGAGTGGGG - Intergenic
1084259127 11:67963351-67963373 CCATCCGGCAGCTCCTAGTGCGG - Intergenic
1084406092 11:68974518-68974540 CCGGCCAGCTGCTCCGAGTGCGG + Intergenic
1084840678 11:71843893-71843915 CCGGCCAGCCGCCCCAAGTGTGG + Intergenic
1085051600 11:73382901-73382923 CCACCCAGCTCCTCCCAGTCTGG - Intronic
1085245584 11:75098289-75098311 CCGGCCGGCTGCTCTGAGTGTGG - Intergenic
1085375869 11:76060647-76060669 CCGGCCGGCCACTCCGAGTGCGG - Intronic
1085863109 11:80257645-80257667 CCGGCGGGCTGCTCCGAGTGGGG - Intergenic
1085886974 11:80533021-80533043 CCAGCCGGCCACTCCGAGTGTGG + Intergenic
1086001624 11:81991156-81991178 CCGGCCGGCTGCTCCAAGTGCGG + Intergenic
1086043017 11:82501241-82501263 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
1086200384 11:84194873-84194895 CTGGCCAGCTGCTCCAAGCGCGG + Intronic
1086311039 11:85536704-85536726 TCAGCCCGCTGCCCTGAGTGCGG - Intronic
1086807999 11:91268839-91268861 CGGGCCGGCTGTTCCGAGTGCGG - Intergenic
1087354524 11:97076683-97076705 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1087486407 11:98763688-98763710 CCGGCCGGCTGCTCTGAGTGCGG + Intergenic
1087966575 11:104422707-104422729 CCAGCCGGCCGCTCTGAGTGCGG + Intergenic
1088481718 11:110301177-110301199 CCGGCCTGCGGCTCCAAGTGCGG + Intergenic
1088570861 11:111222061-111222083 CCTGCCGGCTGCTCCGAGTGCGG - Intergenic
1088843983 11:113649612-113649634 CCGGCCGGCTGCTCCGAGTGGGG + Intergenic
1089170869 11:116510652-116510674 GCAGCCAGCAGCTCCGGGTGCGG - Intergenic
1089244753 11:117110730-117110752 CCGGCCGGCTGCTCTGAGTGCGG + Intergenic
1089466421 11:118689252-118689274 CCGGTCGGCTGCTCCTAGTGCGG + Intergenic
1089666846 11:120025981-120026003 CCGGCCGGCTGCTCCGAGTGTGG - Intergenic
1090364920 11:126197825-126197847 GCAGACAGCTTCTCCCAGTGCGG - Intergenic
1090558160 11:127898842-127898864 CTGGCTGGCTGCTCCGAGTGTGG + Intergenic
1090588247 11:128237173-128237195 CCGGCCGGCTGCTCCGAGCGCGG - Intergenic
1090776740 11:129972098-129972120 CCGGCTGGCTGCTCCGAGTGTGG + Intronic
1090782712 11:130021755-130021777 CCGGCCGGCTGCTCCGAGCGCGG - Intergenic
1091233467 11:134003140-134003162 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1091550683 12:1532659-1532681 CCAGCCAGCTCCTCCGAGCCTGG - Intronic
1092133949 12:6132701-6132723 CTGGCCGGCCGCTCCGAGTGGGG - Intergenic
1092135186 12:6142279-6142301 CTGGCCGGCTGCTCTGAGTGTGG - Intergenic
1092142122 12:6191148-6191170 CGGGCCGGCTGCTCTGAGTGCGG + Intergenic
1092336660 12:7639922-7639944 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1092350537 12:7752351-7752373 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1092366535 12:7881361-7881383 CCGGCCGGCCGCTCCGAGTGCGG - Intronic
1092545868 12:9450662-9450684 CGGGCCGGCCGCTCCGAGTGCGG + Intergenic
1092572439 12:9739854-9739876 CCTGCCGGCTGCTCCGAGTGCGG + Intergenic
1092583823 12:9876318-9876340 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1092617172 12:10225910-10225932 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1093034476 12:14320177-14320199 CCTACCGGCTGCTCCGAGTGGGG - Intergenic
1093189385 12:16057465-16057487 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1093266257 12:17007706-17007728 CCAGCTGGCTGCTCCGAGTGCGG - Intergenic
1093381552 12:18500229-18500251 CCGGCCGGCCGCTCCGAGTGCGG - Intronic
1093524790 12:20093545-20093567 CCCGCTGGCCGCTCCGAGTGTGG + Intergenic
1093527105 12:20115507-20115529 CTGGCCGGCCGCTCCGAGTGCGG + Intergenic
1093652534 12:21661612-21661634 CCGGCCGGCTGCTCCGAGTGCGG - Intronic
1093921650 12:24866159-24866181 CCAGCCGGTCGCTCCGAATGTGG - Intronic
1093970197 12:25369449-25369471 CCGGCCGCCTGCTCCGAGTGCGG - Intergenic
1093972945 12:25391511-25391533 CTGGCCAGCTACTCGGAGTGCGG - Intergenic
1094108769 12:26839258-26839280 CTGGCCGGCTGCTCCGGGTGCGG - Intergenic
1094338627 12:29386518-29386540 CCGGCCGGCTGCTCCAAGTGTGG + Intergenic
1094405366 12:30110726-30110748 CCGGCCGGCCGCTCCAAGTGTGG + Intergenic
1094409820 12:30156953-30156975 CTGGCCGGCTGCTCCCAGTGCGG - Intergenic
1094448702 12:30561716-30561738 CCGGCTGGCTGCTCTGAGTGCGG - Intergenic
1094507087 12:31071411-31071433 CGGGCCGGCTGCTCCGATTGCGG - Intergenic
1094652429 12:32390977-32390999 CCAGCCGGTCGCGCCGAGTGCGG + Intergenic
1094661265 12:32472374-32472396 CTGGCTGGCTGCTCCGAGTGCGG - Intronic
1094666471 12:32525756-32525778 CTGGCTGGCTGCTCCGAGTGCGG - Intronic
1094718211 12:33034209-33034231 CCGGCCGGCTGCTCCGAGTGTGG + Intergenic
1094722047 12:33075428-33075450 CCGTCCGGCTGCTCCGAGTGCGG - Intergenic
1095304140 12:40620739-40620761 CCGGCCTGCCGCTCCGAGTGCGG - Intergenic
1095444970 12:42273980-42274002 CCGGCCGGCCCCTCCGAGTGTGG + Intronic
1095587397 12:43863981-43864003 CTGGCCGGCAGCTCCGAGTGTGG - Intronic
1095776690 12:46018100-46018122 CCAGCCCGCTGCTCCGAGTGCGG - Intergenic
1095898791 12:47306405-47306427 CCAGCCTGCTGCCCGGAGTGCGG - Intergenic
1097017942 12:56000421-56000443 CCAGCCGGCTGCTCCGTGTGCGG + Intronic
1097314737 12:58159809-58159831 GCAGCCAGCTGTTCTGTGTGAGG - Intergenic
1097490927 12:60269824-60269846 CTGGCCGGCCGCTCCGAGTGCGG - Intergenic
1097664203 12:62461511-62461533 CCGGCTAGCGGCTCCCAGTGTGG + Intergenic
1097982001 12:65744441-65744463 CCAGCCAGCTGCTCCTAGTGCGG - Intergenic
1098168237 12:67719510-67719532 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1098515976 12:71376940-71376962 CGGGCCGGCCGCTCCGAGTGCGG - Intronic
1098759226 12:74403029-74403051 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
1098819137 12:75207742-75207764 CCAGGCGGCTGCTTCGAGGGCGG - Exonic
1099204338 12:79711018-79711040 CCGGCCAGCCGCTCCGAGTGCGG - Intergenic
1099716248 12:86296680-86296702 CCGGCCAGCGGCTCCGAGTGCGG + Intronic
1100211903 12:92406796-92406818 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1100584682 12:95969217-95969239 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
1100600630 12:96108987-96109009 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
1101021608 12:100559464-100559486 CTGGCCGGCTGCTCCGAGTGAGG - Intronic
1101461979 12:104905790-104905812 CTGGCTGGCTGCTCCGAGTGCGG + Intronic
1101603833 12:106233104-106233126 GCCGCCGGCTGCTCCGAGTGCGG - Intergenic
1102387251 12:112520167-112520189 CCGGCCTGCCGCTCCAAGTGTGG + Intergenic
1102703668 12:114862561-114862583 CCAGCCATCTGATCCAACTGAGG - Intergenic
1102904008 12:116660808-116660830 CTGGCCGGCGGCTCCGAGTGCGG - Intergenic
1103146164 12:118597453-118597475 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1103439249 12:120950618-120950640 CCGGCCGGCTGCTCCGAGTGTGG + Intergenic
1103678723 12:122676874-122676896 CCGACCGGCCGCTCCGAGTGCGG + Intergenic
1103783410 12:123414391-123414413 CCCGCCAGCTGCTCCGAGTGCGG + Exonic
1103853272 12:123947030-123947052 CCCGCTGGCTGCTCTGAGTGCGG - Intronic
1104344477 12:127983464-127983486 CCGGCCGGCCGCTCGGAGTGTGG - Intergenic
1104582623 12:130022137-130022159 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1104614534 12:130256932-130256954 CTGGCCGGCTGCTCCGGGTGCGG + Intergenic
1104749221 12:131227894-131227916 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1104887418 12:132118849-132118871 CCAGCGAGCTGCGCGGCGTGCGG - Intronic
1105037733 12:132938836-132938858 CTGGCTGGCTGCTCCGAGTGCGG - Intronic
1105425627 13:20292499-20292521 CTGGCCGGCCGCTCCGAGTGCGG - Intergenic
1105477404 13:20740206-20740228 CCAGCCGGCTGCTCCGAGTGCGG + Intronic
1105697236 13:22900686-22900708 CCAGCTTGCTGCTCCGAGTGCGG + Intergenic
1105701557 13:22938915-22938937 CCAGCCGGCTGCTGGGAGTGTGG + Intergenic
1105722162 13:23127654-23127676 CGGGCTGGCTGCTCCGAGTGCGG - Intergenic
1105871161 13:24507084-24507106 CCAGCGGGCTGCTCAGAGTGCGG + Intronic
1105876700 13:24560983-24561005 CCCGCCCGCCGCTCTGAGTGCGG + Intergenic
1105883470 13:24623439-24623461 CCAGCAGGCCGCTCTGAGTGTGG - Intergenic
1106221344 13:27748592-27748614 CTGGCCGGCTGCTCTGAGTGCGG + Intergenic
1106600561 13:31183286-31183308 CCGGCCTGCCGCTCCGAGTGCGG + Intergenic
1106617082 13:31339944-31339966 CTGGCTCGCTGCTCCGAGTGCGG + Intergenic
1106810932 13:33358063-33358085 CTGGCTGGCTGCTCCGAGTGTGG - Intergenic
1107590482 13:41898857-41898879 CCGGCCGGCTGCTCCGAGTGTGG + Intronic
1107652575 13:42559852-42559874 CCCGCCGGCCGCTCCGAGTGCGG - Intergenic
1107836096 13:44413658-44413680 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1108099197 13:46936333-46936355 CTGGCTGGCTGCTCCGAGTGGGG + Intergenic
1108435324 13:50396677-50396699 CCAGCCGGCTGCTCCGAATGCGG - Intronic
1108643992 13:52408354-52408376 CCCACCGGCCGCTCCGAGTGCGG + Intergenic
1108686716 13:52826343-52826365 CCGGCCAGCCACTCTGAGTGAGG - Intergenic
1108856539 13:54799956-54799978 CCGGCCAGCTGCTCCGAGTGCGG + Intergenic
1108995999 13:56735691-56735713 CCGGCCAGCCGCTCCCAGTGCGG - Intergenic
1109124717 13:58504504-58504526 CCAGCTGGCTGCTCCGAATGCGG + Intergenic
1109141029 13:58714165-58714187 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1109145392 13:58773400-58773422 CCGGCCAGCTGCTCCCAGTGTGG - Intergenic
1109441349 13:62379309-62379331 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1109563174 13:64077772-64077794 CCGGCCGGCCGCTCCAAGTGCGG + Intergenic
1109638107 13:65149851-65149873 CCAGCTGGCCGCTCTGAGTGAGG + Intergenic
1109741517 13:66561148-66561170 CCAGCCGGCCGCTCCGAGTGCGG - Intronic
1109745802 13:66622031-66622053 CCGGCCGGCTGCTCCGAGTGCGG - Intronic
1110024085 13:70512183-70512205 CCAGCAGGCTCCTCCGAATGCGG + Intergenic
1110440179 13:75518635-75518657 TCGCCCAGCCGCTCCGAGTGTGG - Intergenic
1110792412 13:79600436-79600458 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1110862117 13:80355629-80355651 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1110940314 13:81341048-81341070 CGGGCCGGCTGCTCCGGGTGCGG + Intergenic
1110999860 13:82165228-82165250 CCAGCCAGCTGCTCCGAGTGTGG + Intergenic
1111138797 13:84086654-84086676 CCGGCCGGCCGCTCCGAGTGCGG + Intergenic
1111220890 13:85204995-85205017 CCAGCCGGCCACTCCAAGTGCGG - Intergenic
1111333554 13:86792347-86792369 CCGGCCGGCCGCTCGGAGTGTGG - Intergenic
1111441889 13:88291902-88291924 CCGGCCAGCTGCTCCGAGTGCGG - Intergenic
1111591006 13:90348681-90348703 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1112518626 13:100077598-100077620 CCGGCTGGCTGCTCCGAGTGCGG - Intergenic
1112533186 13:100224327-100224349 CCAGCCGGCTGCTCCGAGTGCGG + Intronic
1112613080 13:100975779-100975801 CCGGCCCGCTGCTCCGAGTGCGG - Intergenic
1113482701 13:110633307-110633329 CTGGCCGGCTGCTCCGAGTGCGG + Intronic
1113487326 13:110663734-110663756 CCTGCCATCTGCTCTCAGTGTGG - Intronic
1113538151 13:111084150-111084172 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1113839554 13:113351029-113351051 CCCTCCAGCTGCCCCGAGGGTGG + Intronic
1114431806 14:22667819-22667841 CCAGCAAGCTGCTCCTGGTGAGG + Intergenic
1114593519 14:23891839-23891861 CTGGCCCGCTGCTCCAAGTGCGG - Intergenic
1115118267 14:29909079-29909101 CCGGCCAGCCACTCTGAGTGTGG - Intronic
1115268648 14:31527364-31527386 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
1116152142 14:41154517-41154539 CCGGCCGGCCGCTCTGAGTGTGG + Intergenic
1116251048 14:42482667-42482689 GCCGCCGGCTGCTCTGAGTGCGG + Intergenic
1116437585 14:44912252-44912274 GCGGCCGGCCGCTCCGAGTGCGG - Intergenic
1116452342 14:45080519-45080541 CCGGTCGGCTGCTCCGAGTGCGG - Intergenic
1116594366 14:46820517-46820539 CTGGCCGGCCGCTCCGAGTGCGG - Intergenic
1117077851 14:52122326-52122348 CCGGCCAGCTGCTCGGAGTGCGG - Intergenic
1117302492 14:54443134-54443156 GCGGCCGGCTGCTCCGAGTGAGG - Intergenic
1117449801 14:55839591-55839613 CCGGCCGGCCGCTCTGAGTGCGG - Intergenic
1117571941 14:57056893-57056915 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1117727351 14:58687531-58687553 CCGGCCGGCCGCTCCAAGTGTGG + Intergenic
1117837265 14:59819846-59819868 CCAGCCAGCCGCTCCGAGTGCGG + Intronic
1118215384 14:63803541-63803563 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1119027770 14:71167622-71167644 CCCGCCGGCCGCTCCGAGTGCGG - Intergenic
1119300337 14:73566611-73566633 CCAGCTGGCGGCTCCGAGTGTGG + Intergenic
1119303687 14:73590712-73590734 CCGGCCGGCCGCTCCAAGTGCGG + Intergenic
1119486762 14:74994231-74994253 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1119673466 14:76537028-76537050 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1119870718 14:78014259-78014281 CTGGCCGGCTGCTCTGAGTGTGG + Intergenic
1120030115 14:79631524-79631546 TCAGCCGGCTGCGCCCAGTGCGG - Intronic
1120169668 14:81236181-81236203 CCAGCCGGCTGCTCTGAGTGTGG - Intergenic
1120209885 14:81624044-81624066 CTGGCCGGCCGCTCCGAGTGCGG + Intergenic
1120214693 14:81668989-81669011 CCAGCTGGCTGCTCGGAGTGCGG + Intergenic
1120229783 14:81829733-81829755 GCGGCCAGCTGCTCGGAGTGTGG + Intergenic
1120330964 14:83092467-83092489 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1120429768 14:84399642-84399664 CCGGCCGGCCGCTCTGAGTGCGG + Intergenic
1120439129 14:84513187-84513209 CCAACTGGCTGCTCCCAGTGCGG + Intergenic
1120844146 14:89111730-89111752 CCGGCCGGCTGTTCCGAGTGCGG - Intergenic
1121145365 14:91578052-91578074 CAGGCCAGCCGCTCCGAGTGCGG - Intergenic
1121169680 14:91843110-91843132 CCAGCCAGCTGCTCCAAGGAGGG + Intronic
1122216546 14:100208436-100208458 CCGGCTGGCCGCTCCGAGTGTGG + Intergenic
1122277987 14:100605046-100605068 CCTGCCAGCAGCTCCGGGTGAGG + Intergenic
1122503205 14:102215408-102215430 CCAGCCAGCAGCTGGGAGAGTGG + Intronic
1123799124 15:23802996-23803018 CCGGCCGGCTGCTCCAAGTGCGG - Intergenic
1123949147 15:25253471-25253493 CCGGCCCGCTGCTCCGAGTGTGG + Intergenic
1124114877 15:26831457-26831479 CCGGCTGGCTGCTCCGAGGGTGG + Intronic
1124252399 15:28115460-28115482 CCAGCCAGCTGCTTCCAGACAGG + Exonic
1124573110 15:30883839-30883861 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1125112199 15:36047037-36047059 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
1125480309 15:40075051-40075073 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1125565770 15:40677205-40677227 CCGGCTGGCTGCTTCGAGTGCGG + Intergenic
1125609685 15:40961700-40961722 CTGGCCGACTGCTCCGAGTGCGG - Intergenic
1125631586 15:41151765-41151787 CCGGCTGGCCGCTCCGAGTGCGG - Intergenic
1125885558 15:43226827-43226849 CTGGCCAGCCGCTCCGAGTACGG + Intergenic
1126088974 15:45034917-45034939 CCGGCCGGCTGCTCTGAGTGCGG - Intronic
1126165545 15:45651282-45651304 CCAGCCTGCCACTCCAAGTGCGG + Intronic
1126301918 15:47206841-47206863 ACAGCAAGCTGCTCCCACTGGGG + Intronic
1126900910 15:53313518-53313540 GCAGGAAGCTGCTCAGAGTGGGG + Intergenic
1127054088 15:55114004-55114026 CCAGCCACCTGCTCCAATTTAGG + Intergenic
1127766082 15:62186840-62186862 CCAGCGGGCTGCTCCGAGTGCGG + Intergenic
1127984760 15:64060966-64060988 CCAGCCAGCGGCTCTGAGTGCGG - Intronic
1128516852 15:68347644-68347666 CCAAGCAGCTGCTCCGTGAGAGG - Intronic
1128669995 15:69567636-69567658 CCAGCTGGCTGCTCCGAGTGCGG + Intergenic
1128813326 15:70587452-70587474 CCGTCCGGCTGCTCCGAGTGCGG + Intergenic
1129196922 15:73973831-73973853 CCGGCCGGCCGCACCGAGTGCGG - Intergenic
1129280411 15:74480623-74480645 CTGGCCGACTGCTCCGAGTGCGG + Intergenic
1129466046 15:75724952-75724974 CCATCCAGCTGCTTCGTTTGGGG - Intronic
1129724405 15:77894251-77894273 CCGGCCAGCTGCTCCGAGTGCGG + Intergenic
1129859150 15:78846956-78846978 CTGGCTGGCTGCTCCGAGTGCGG - Intronic
1130010809 15:80152402-80152424 CCAGCTAGCTGCCCCGAGCGGGG + Intergenic
1130132845 15:81158705-81158727 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1131472840 15:92711295-92711317 CCGGCCGGCCGCTCCAAGTGCGG + Intronic
1131507772 15:93031910-93031932 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1131846139 15:96492115-96492137 CCGGCCAGCTGCTCCGAGTGCGG + Intergenic
1131912577 15:97224330-97224352 CCGGCCAGCGGCTCCAAGTGCGG - Intergenic
1132063935 15:98715065-98715087 CTGGTCAGCTGCTCCCAGTGTGG + Intronic
1132836841 16:1958477-1958499 CCGGCCAGGCTCTCCGAGTGCGG + Intergenic
1133041893 16:3065314-3065336 CCAGCCAGCTGTCCCGAGTCTGG + Intronic
1133362659 16:5186600-5186622 CCTGCCGGCCGCTCCGAGTGCGG + Intergenic
1134092633 16:11399669-11399691 CCTGACCGCTGCACCGAGTGAGG - Intronic
1134127994 16:11629593-11629615 GGAGCCGGCTGCTTCGAGTGTGG - Intronic
1135262140 16:20989918-20989940 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
1135280833 16:21152680-21152702 CCAGCTGGCTGCTCCCAGTGCGG - Intronic
1135299409 16:21313058-21313080 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1135751085 16:25059188-25059210 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1136233749 16:28902595-28902617 CCAGGCAGCTGCTCCCACGGTGG - Exonic
1136356630 16:29748440-29748462 CCAGCCGGCCTCTCTGAGTGCGG - Intergenic
1136477937 16:30525004-30525026 CCCTACAGCTGCACCGAGTGCGG - Exonic
1136518754 16:30783357-30783379 CCATACCGCTGCACCGAGTGCGG - Exonic
1136518823 16:30783777-30783799 CCCAACACCTGCTCCGAGTGCGG - Exonic
1137734214 16:50712077-50712099 CCCGCCAGCTGCACCGGGTGAGG + Exonic
1137945685 16:52731500-52731522 CCAGCTGGCTGCTCAGAGTGCGG - Intergenic
1138168820 16:54829899-54829921 TCGGCCGGCCGCTCCGAGTGCGG - Intergenic
1138693621 16:58791063-58791085 GCTGCCGGCTGTTCCGAGTGTGG + Intergenic
1139147718 16:64343978-64344000 CCAGCCCGCCACTCCGAGTGCGG - Intergenic
1139442297 16:66974362-66974384 CCGGCCAGCTGCTCTGAGTGGGG - Exonic
1139520538 16:67480424-67480446 CCAGCCAGCAGTTCAGAGTTGGG + Intronic
1139600286 16:67982359-67982381 CCGGCTGGCCGCTCCGAGTGCGG - Intergenic
1139603032 16:67998297-67998319 CCCGCGGGCCGCTCCGAGTGCGG - Intronic
1139608338 16:68036449-68036471 TTAGCCAGCTGGGCCGAGTGAGG - Intronic
1139907450 16:70376442-70376464 CCAGCCTGGTCCTCAGAGTGTGG - Exonic
1139919605 16:70451074-70451096 TCGGCCGGCTACTCCGAGTGCGG + Intergenic
1140722539 16:77784656-77784678 CCGGCCGGCCGCTCCGAGTGAGG + Intergenic
1141270346 16:82534078-82534100 CCAGGCAGCTACTCTGGGTGAGG + Intergenic
1141639566 16:85333439-85333461 CCTGCCGGCTCCTCTGAGTGCGG + Intergenic
1141849984 16:86638570-86638592 CCAGGCAGCTGCTCTCAGGGAGG - Intergenic
1142060756 16:88027683-88027705 CAGGCCAGCTGCCCCGAGCGGGG - Intronic
1143127998 17:4656786-4656808 CCGGCCAGCCGCTCCGAGTGCGG + Intergenic
1144083625 17:11786909-11786931 GCTGTCAGCTGCTCCAAGTGTGG + Intronic
1144128071 17:12220988-12221010 CTAGCCGGCCGCTCCGAGGGCGG - Intergenic
1144467140 17:15505780-15505802 CTGGCCGGCTGCTCCGAGTGCGG - Intronic
1144723196 17:17486436-17486458 CTGGCCGGCTGCTCCGAGTGCGG - Intronic
1145050326 17:19654593-19654615 CCGGCCAGCTGCTCCGAGTGTGG + Intronic
1145766106 17:27459272-27459294 CCTGGCAGCTGCCCCTAGTGAGG + Intronic
1146740485 17:35279191-35279213 CCAGCCGGCTGCTCTGAGTTTGG + Intergenic
1146915658 17:36676758-36676780 CCAGGCACCTTCTCCCAGTGGGG + Intergenic
1146955522 17:36934697-36934719 CCAGCCTGCTGCGCTGCGTGAGG - Intergenic
1147373608 17:40011016-40011038 CTGGCCCGCTGCTCCGAGTGCGG - Intergenic
1147660533 17:42114664-42114686 GCAGCCAGTGGCTCCGACTGTGG - Intronic
1147952017 17:44112652-44112674 CCAGCCAGCTTCTGCCAGTCAGG + Intronic
1147997515 17:44368906-44368928 CCGGCTGGCTGCTCCGAGTGCGG - Intergenic
1148366195 17:47057560-47057582 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1148695267 17:49555010-49555032 CCAGCCAGGTGCTCCGGGCCGGG - Intergenic
1148722013 17:49760609-49760631 GCACCCAGCTGGTCCCAGTGGGG + Intronic
1148991234 17:51668854-51668876 CCGGCCGGCCGCTCCAAGTGTGG - Intronic
1150772265 17:68051955-68051977 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
1150778262 17:68099365-68099387 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1150786766 17:68169635-68169657 CCGGCCGGCTGCTCTGAGTGCGG + Intergenic
1150788250 17:68179931-68179953 CCGGCCAGCCGCTCTGAGTGCGG - Intergenic
1150804625 17:68309187-68309209 CCAGCTGGCTGCTCCGAGTGCGG + Intronic
1151323249 17:73364098-73364120 CCAGCCAGGTGCTGGGGGTGTGG - Intronic
1151438521 17:74113593-74113615 TCGGCCGGCCGCTCCGAGTGCGG + Intergenic
1151840662 17:76615187-76615209 CCGGCCAGCCGCTCTGAGTGTGG + Intergenic
1152317123 17:79587631-79587653 CCAGCCTGCTGCTCCGTGGGGGG - Intergenic
1152619071 17:81352325-81352347 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1153644074 18:7178943-7178965 CCGGCTGGCTGCTCCGAGTGTGG + Intergenic
1153832480 18:8935700-8935722 CTGGCCGGCTGCTCCGAGTGTGG + Intergenic
1153868692 18:9297019-9297041 CCAGCCGGCCGCTCTGAGTGTGG - Intergenic
1154047157 18:10916560-10916582 CCAGCAGGCCGCTCTGAGTGTGG + Intronic
1154097620 18:11432568-11432590 CCAGCCGGCCTCTCCGAGTGCGG + Intergenic
1154128766 18:11717189-11717211 CCAGCCGGCCGCTCCCAGTGCGG + Intronic
1154255332 18:12777131-12777153 CCGGCCGGCCGCTCCGAGTGTGG + Intergenic
1155208069 18:23577908-23577930 CTGGCTGGCTGCTCCGAGTGTGG + Intronic
1155271973 18:24149831-24149853 CCGGCCCGCTGCTCGGAATGCGG + Intronic
1155295049 18:24376857-24376879 CCGGCCGGCTGCTCCCAGTGCGG + Intronic
1155308680 18:24503141-24503163 CCATCCTGCTCCTCTGAGTGAGG + Intergenic
1155852267 18:30788527-30788549 CTGGCCGACTGCTCCGAGTGCGG - Intergenic
1155856394 18:30839436-30839458 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1156038652 18:32794658-32794680 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1156079495 18:33316309-33316331 GCAGCCGGCCGCTTCGAGTGTGG - Intronic
1156629070 18:38944680-38944702 CAGGCCTGCTGCTCCGAGTGCGG + Intergenic
1156657809 18:39309176-39309198 CCGGCTGGCTGCTCCGAGTGTGG - Intergenic
1156863641 18:41865840-41865862 CCGGCCGGCTGCTCCGAGTGTGG - Intergenic
1157085953 18:44580816-44580838 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
1157935196 18:51864647-51864669 CCAGCTGGCTGCTCCGAGTGTGG + Intergenic
1158282321 18:55840973-55840995 CCCGCTGGCGGCTCCGAGTGCGG + Intergenic
1158304468 18:56089438-56089460 CAAGGCAGCTGCCCCAAGTGAGG - Intergenic
1158351900 18:56572373-56572395 CTGGCCGGCTGCTCGGAGTGCGG - Intergenic
1158705771 18:59790728-59790750 TTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1159167971 18:64725907-64725929 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1159458653 18:68694402-68694424 CCAGGCACCTGCTCCATGTGAGG - Intronic
1159472966 18:68880272-68880294 CTGGCCAGCTGCTCCGAGTGCGG + Intronic
1159656123 18:71031616-71031638 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1159670227 18:71212758-71212780 CCGGCCGGCAGCTCTGAGTGCGG + Intergenic
1160176639 18:76600407-76600429 CTGGCCGGCTGCTCCGAGTTAGG + Intergenic
1160198537 18:76777328-76777350 CCAGCCGGCTGCTCCGAGTGCGG - Intergenic
1161268100 19:3374517-3374539 CCAGCCACCTTCTCCGACAGTGG + Intronic
1161829179 19:6590474-6590496 CCAGCCACTCGCTCCGGGTGGGG - Intronic
1162230128 19:9259597-9259619 CCGGCCTGCTGCTCCGAGTGCGG - Intergenic
1162233131 19:9283731-9283753 CAGGCCGGCTGCTCGGAGTGCGG + Intergenic
1162357516 19:10195125-10195147 CGAGCCCACTGCTCCGCGTGGGG - Intronic
1162632719 19:11941573-11941595 TCGGCCGGCTGCTCCGAGTGCGG + Intronic
1162987088 19:14277708-14277730 CCAGCCTGCTGCTCCGAGTGCGG - Intergenic
1163181739 19:15608922-15608944 CCGGCTGGCTGCTCCCAGTGCGG + Intergenic
1163218828 19:15899766-15899788 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1164310442 19:24041397-24041419 CTGGCTGGCTGCTCCGAGTGTGG - Intronic
1164598998 19:29548674-29548696 CCCGCCAGATGCTCCCAGGGTGG + Intronic
1164725274 19:30461788-30461810 CTAGCCCGCAGCTCCGTGTGGGG + Intronic
1164975776 19:32571671-32571693 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
1165108111 19:33486388-33486410 CCAGGCAGCAGTTCCGTGTGTGG - Intronic
1165266920 19:34668277-34668299 CCGGCCGGCAGCTCGGAGTGCGG - Intronic
1166036240 19:40170418-40170440 CCTGCCGGCTGCTCCAAGTGCGG + Intergenic
1166649742 19:44563482-44563504 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1167515715 19:49922092-49922114 ACAGCCAGCAGCTCTGAGTCAGG - Intronic
925098991 2:1229872-1229894 AGGGCCGGCTGCTCCGAGTGCGG + Intronic
926616652 2:15002812-15002834 CGGGTCAGCTGCTCCAAGTGCGG + Intergenic
927524189 2:23721883-23721905 CCAGCCTGCTTCTCAGATTGAGG - Intergenic
928493068 2:31803802-31803824 CCGGCAGGCTGCTCCGAGCGCGG - Intergenic
928599209 2:32886845-32886867 CCGGCCGGCTGCTTCAAGTGCGG + Intergenic
928723133 2:34142804-34142826 CCAGCTGGCTGCTCCAAGTGTGG + Intergenic
928753177 2:34494376-34494398 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
928880563 2:36092324-36092346 CCAGCTGGCTGCTCCGAGTGCGG - Intergenic
928936877 2:36688344-36688366 CCAGCCGGCTGCTCGGAGTGCGG - Intergenic
929138037 2:38643338-38643360 CCGGCCGGCTGCTCGGAGTGCGG + Intergenic
929201839 2:39244358-39244380 CCGGCGGGCTGCTCAGAGTGCGG - Intergenic
929379669 2:41335673-41335695 CCGGCCTGCTGCTCCGAGTGCGG - Intergenic
929437862 2:41941917-41941939 GAACCCAGCTGCTCCAAGTGTGG + Intronic
929890891 2:45917951-45917973 GCGGCCGGCTGCTCCGAGTGCGG + Intronic
930037997 2:47099815-47099837 CCCACCAGCTGCTCTGAGTGTGG - Intronic
930039194 2:47107363-47107385 CCGGCCAGCTGCTCCGAGTGCGG - Intronic
930485488 2:52006882-52006904 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
930593376 2:53356517-53356539 CTGGCTGGCTGCTCCGAGTGTGG - Intergenic
931106954 2:59067011-59067033 CCGGCCAGCCGCTCCGAGGGCGG - Intergenic
932239916 2:70148388-70148410 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
932359536 2:71092764-71092786 CCAGCCGGTTGCTCCGAGTGTGG + Intergenic
932521756 2:72421910-72421932 CTGGCCGGCTGCTCTGAGTGCGG - Intronic
932794025 2:74679840-74679862 CCAGCGAGATGCTCCGAGCCGGG + Exonic
932983487 2:76698397-76698419 TCCGCTGGCTGCTCCGAGTGCGG + Intergenic
933442091 2:82326483-82326505 CCGGCTGGCCGCTCCGAGTGAGG + Intergenic
933487276 2:82938722-82938744 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
933506313 2:83181126-83181148 CCGGCTGGCTGCTCCAAGTGTGG - Intergenic
933531618 2:83518253-83518275 CCAGCTGGCCGCTCTGAGTGCGG - Intergenic
934085112 2:88503221-88503243 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
934460506 2:94211863-94211885 CCACCCAGCTGCTCCGTGCCAGG + Intergenic
934754638 2:96816611-96816633 ACCGCCAGCAGCGCCGAGTGCGG - Exonic
934898475 2:98139086-98139108 CCGGCCGGCTGCTCCGAGTGCGG - Intronic
935896873 2:107747616-107747638 CCGGCCGGCTGCTCCAAGTGCGG + Intergenic
935922538 2:108031647-108031669 CCAGCCAGCCACTCCGAGTGCGG - Intergenic
936346869 2:111681933-111681955 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
936581542 2:113704682-113704704 CCTGCCGGCCGCTCCGAGTGCGG + Intergenic
937181121 2:119997066-119997088 CCGGCCGGCGGCTCCGAGTGCGG - Intergenic
937209613 2:120260028-120260050 CTGGCTGGCTGCTCCGAGTGCGG + Intronic
937562624 2:123244506-123244528 CCAGTCTGCAGCTCCCAGTGAGG + Intergenic
938089360 2:128421091-128421113 CCAGGCAGCTGCCCTCAGTGAGG - Intergenic
938153149 2:128903796-128903818 CCAGCCGGCTGCGCTGAGGGTGG + Intergenic
938507541 2:131902222-131902244 CCAGCCAGTTCCTCCGTTTGGGG + Intergenic
938728761 2:134130021-134130043 CCAGCCGGCCGCTCCGAGTGCGG - Intronic
939053235 2:137331885-137331907 CCGGCCGGCTGCTCCAAGTGCGG + Intronic
939085659 2:137715879-137715901 CCAGCTGGCTGCTCTGAGTGTGG - Intergenic
939229738 2:139410423-139410445 CCGGCCGGCTGCTCCGAGTGTGG - Intergenic
939275225 2:139990977-139990999 CCAGCCGGCCGCTCCCAGGGCGG + Intergenic
939465112 2:142546144-142546166 CCGGCCGCCCGCTCCGAGTGCGG - Intergenic
939738800 2:145881186-145881208 CCGGCAGGCTGCTCCGAGTGAGG + Intergenic
939898895 2:147826943-147826965 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
940112663 2:150171304-150171326 CCGGCCGGCCGCTCAGAGTGCGG + Intergenic
940453817 2:153872199-153872221 CCGGCCGGCCGCGCCGAGTGCGG - Exonic
940666726 2:156618335-156618357 CCGGCTGGCTGTTCCGAGTGCGG + Intergenic
940784618 2:157968148-157968170 CCGGCCGGCGGCTCCGAGTGCGG + Intronic
941240066 2:163026358-163026380 CCGGCCGTCTGCTCTGAGTGCGG - Intergenic
941309230 2:163909605-163909627 CCGGCAGGCCGCTCCGAGTGCGG - Intergenic
941309766 2:163913697-163913719 CCGGCTGGCTGCTCAGAGTGCGG - Intergenic
941397949 2:164995032-164995054 CCCGCCGGCTGCTCCGAGTGCGG + Intergenic
941705890 2:168657716-168657738 CAGGCTGGCTGCTCCGAGTGCGG + Intronic
942170273 2:173282865-173282887 GCGGCCGACTGCTCCGAGTGCGG + Intergenic
942368684 2:175257280-175257302 CCAGCCCGCCGCTTCGAGTGCGG + Intergenic
942867269 2:180691470-180691492 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
943166089 2:184327930-184327952 CCGGCCGGCAGCTCCGAGTGCGG + Intergenic
943222822 2:185132682-185132704 CAGGCCGGCTGCTCCGAGTCCGG - Intergenic
943494772 2:188606671-188606693 CCCGCCGGCTCCTCTGAGTGCGG + Intergenic
943520636 2:188944702-188944724 CCAGCCGGCCACTCCGAGTGCGG + Intergenic
943680368 2:190761241-190761263 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
943835143 2:192508051-192508073 CCAGCTGGCCGCTCCGAGTGCGG - Intergenic
943941456 2:194003015-194003037 CCAGCCAGCTGCTCTGAGTGTGG + Intergenic
943954898 2:194176396-194176418 CCGGCCGGCGGCTCCAAGTGTGG - Intergenic
944228413 2:197370654-197370676 CCGGCTGGCCGCTCCGAGTGCGG - Intergenic
944252501 2:197591820-197591842 CCAGCCGGCCGCTCTGAGTGTGG + Intronic
944482789 2:200174866-200174888 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
944728580 2:202496993-202497015 CTGGCCGGCTGCTCCGAGTGCGG - Intronic
944843149 2:203643105-203643127 CCGGCCGACCGCTCCGAGTGCGG + Intergenic
945575495 2:211524654-211524676 GCCGCCGGCTGCTCCGAGTGCGG + Intronic
945869132 2:215207956-215207978 CTGGACAGCTGCTCCGAGTGCGG - Intergenic
945870200 2:215219141-215219163 CTGGCCTGCTGCTCTGAGTGTGG - Intergenic
945872845 2:215246006-215246028 CCAGCTGGCCGCTCCGAGTGTGG + Intergenic
946053981 2:216885331-216885353 CCAGCCGGCAGCTCCGAGTGCGG - Intergenic
946177168 2:217928936-217928958 CCTGGCAGCTGCTCTGTGTGTGG - Intronic
946376492 2:219312903-219312925 CTGGCCGGCCGCTCCGAGTGCGG - Intergenic
946982187 2:225229726-225229748 CCGGCCTGCTGCTCCGAGTGCGG + Intergenic
947026609 2:225744212-225744234 CCCGCCGGCTGCTCCGAGTGCGG - Intergenic
947720403 2:232366423-232366445 CCGGCCGCCTGCTCAGAGTGCGG - Intergenic
947932076 2:233972745-233972767 CCGGCCGGCTGCTCCCAGTGCGG + Intronic
1169849177 20:10031764-10031786 CTGGCCGGCTGCTCCGAGTGCGG - Intronic
1170230883 20:14045060-14045082 CCGGCTTGCCGCTCCGAGTGCGG + Intronic
1170806869 20:19639911-19639933 CTGGCCGGCTGCTCCGAGTGCGG + Intronic
1170989866 20:21291954-21291976 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1171318869 20:24220998-24221020 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1171973445 20:31578838-31578860 CCGGCCAGCCGCTCCAAGTGCGG + Intergenic
1172431877 20:34899080-34899102 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
1172665765 20:36598624-36598646 ACTGCCAGCTGCTTGGAGTGGGG - Intronic
1172700090 20:36847908-36847930 CCAGCCAGCTGCAAAGAGTTAGG + Intronic
1173195543 20:40910747-40910769 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1173601578 20:44299216-44299238 CCGGCCGGCTGTTCCGAGTGCGG - Intergenic
1173831494 20:46091934-46091956 CGGGCCGGCCGCTCCGAGTGTGG - Intergenic
1174162895 20:48564341-48564363 CCGGCCAGCCGCTCCGAGTGCGG + Intergenic
1175210048 20:57348479-57348501 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1175254134 20:57628877-57628899 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1176332306 21:5559884-5559906 CCAGCCGGCGGCTCCGAGTGTGG + Intergenic
1176344843 21:5733751-5733773 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
1176351657 21:5854335-5854357 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
1176395451 21:6261067-6261089 CCAGCCGGCGGCTCCGAGTGTGG - Intergenic
1176441706 21:6728037-6728059 CCAGCCGGCGGCTCCGAGTGTGG + Intergenic
1176465968 21:7055106-7055128 CCAGCCGGCGGCTCCGAGTGTGG + Intronic
1176489529 21:7436884-7436906 CCAGCCGGCGGCTCCGAGTGTGG + Intergenic
1176499984 21:7590704-7590726 CCAGCTGGCCGCTCCAAGTGCGG - Intergenic
1176539164 21:8131821-8131843 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
1176558115 21:8314866-8314888 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
1176591634 21:8654902-8654924 CCACCCAGCTGCTCCGTGCCAGG + Intergenic
1176663733 21:9664346-9664368 CTGGCCAGTCGCTCCGAGTGCGG + Intergenic
1176671025 21:9735621-9735643 CCAGCTGGCCACTCCGAGTGTGG - Intergenic
1176966636 21:15218853-15218875 CTTGCTGGCTGCTCCGAGTGCGG + Intergenic
1177273940 21:18882576-18882598 CATGGCAGCTGCTCCGTGTGTGG + Intergenic
1177565846 21:22819117-22819139 CCGGCCGGCTGCTCCGAGTGTGG + Intergenic
1177637600 21:23807100-23807122 CCGGCCGGCTGCTCCACGTGCGG - Intergenic
1178326980 21:31654276-31654298 CCTGCCGGCTGCTCCGAGTGCGG - Intergenic
1178585662 21:33868594-33868616 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
1180274482 22:10632014-10632036 CCACCCAGCTGCTCCGTGCCAGG + Intergenic
1180741064 22:18053634-18053656 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1180755081 22:18155607-18155629 CCGGCTGGCCGCTCCGAGTGCGG - Intronic
1181077680 22:20392634-20392656 CCGGCTGGCAGCTCCGAGTGCGG + Intergenic
1181636009 22:24175232-24175254 CCATCCAGCTGCTCTGCCTGAGG - Intronic
1181646204 22:24232900-24232922 CCATCGCGCTGCTCCGAGGGGGG - Exonic
1181851469 22:25752885-25752907 CGAGCCGGCCGCTCCGAGTACGG - Intronic
1181915388 22:26275759-26275781 ACAGCCAGATGCTCCAACTGAGG - Intronic
1182479365 22:30596943-30596965 CCGGCTGGCTTCTCCGAGTGCGG - Intronic
1182742351 22:32577190-32577212 CAAGCAAGCTGCTCAGAATGGGG - Intronic
1182871325 22:33650395-33650417 GCAGGCAACAGCTCCGAGTGTGG - Exonic
1183405231 22:37627251-37627273 CAGCCCAGCTGCTCAGAGTGTGG - Intronic
1183422142 22:37718117-37718139 CCAGCCGGCCGCTCCGAGTGCGG + Intronic
1183685196 22:39357620-39357642 CTGGCCGGCTGCTCCGAGGGCGG - Intronic
1183685221 22:39357682-39357704 CTGGCCGGCTGCTCCGAGGGCGG - Intronic
1184673373 22:46027428-46027450 CCAGCCCGCGGCGCCGCGTGGGG + Intergenic
1185233693 22:49699070-49699092 CCAGGCAGGTGCTCAGCGTGAGG + Intergenic
1203244112 22_KI270733v1_random:48176-48198 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
949292738 3:2484991-2485013 CCAGCCCGCTGCTCTGAGTGCGG - Intronic
950203584 3:11061465-11061487 CCGGCCGGCCGCTCTGAGTGTGG - Intergenic
950204869 3:11071500-11071522 CCGGCTGCCTGCTCCGAGTGCGG + Intergenic
950256978 3:11513520-11513542 CCAGCCGGCCGCTCCCAGTGCGG + Intronic
950418544 3:12882974-12882996 CCGGCCAGCAGCTCCGAGTGCGG - Intergenic
950632626 3:14293290-14293312 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
950929377 3:16773799-16773821 CCGGCTGGCTGCTCCAAGTGCGG - Intergenic
951024955 3:17818273-17818295 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
951184957 3:19702652-19702674 CCAGCCGGCCGCTCCGAGTGCGG - Intergenic
951323220 3:21271899-21271921 CCGGCCAGCTGCTCCGAGTGCGG + Intergenic
951415423 3:22417035-22417057 CCGGCCAGCCGCTCTGAGGGCGG - Intergenic
951491249 3:23272281-23272303 CCGGCCGGCTTCTCTGAGTGTGG + Intronic
951551897 3:23882813-23882835 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
951951108 3:28200690-28200712 CCGGCTGGCGGCTCCGAGTGCGG + Intergenic
952011295 3:28903443-28903465 CCAGCTGGCTGCTCCAAGTGCGG + Intergenic
952058107 3:29473779-29473801 CCGGCCAGCCCCTCCAAGTGTGG + Intronic
952076300 3:29701659-29701681 CCGGCCAGCCTCTCCGAGTGCGG - Intronic
952275229 3:31870204-31870226 CCCGCCGGCTGCTCGGAGTGCGG - Intronic
952355371 3:32578837-32578859 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
952360454 3:32625723-32625745 CCGGCCAGCCACTCAGAGTGCGG - Intergenic
952393693 3:32902877-32902899 CCGGCGGGCCGCTCCGAGTGCGG - Intergenic
952453680 3:33453532-33453554 CAGGCCAGCCGCTCCGAGTCTGG - Intergenic
952730623 3:36633990-36634012 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
952795228 3:37233086-37233108 CCGGCAGGCTGCTCCGAGTGCGG - Intergenic
953002871 3:38951235-38951257 CCAGCCGGCTGCTCCGAGTGCGG - Intergenic
953089806 3:39713399-39713421 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
953124532 3:40078204-40078226 CCAGCTGGCTGCTCCGAGTGCGG + Intronic
953423015 3:42769795-42769817 CCAGCCGGCTGCTTGGAGTGTGG - Intronic
953522510 3:43656703-43656725 CCGGCCGGCTGCTCTGAGTGTGG + Intronic
954089341 3:48272200-48272222 CCGGCCGGCCGCTCCGAGTGTGG + Intronic
955111783 3:55957746-55957768 CCAGGCGCCTGCTCCGTGTGAGG + Intronic
955183331 3:56691962-56691984 CCGGCCGGCTGCTCCGAGTGTGG - Intergenic
955186408 3:56719016-56719038 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
955210272 3:56934549-56934571 GCCGGCAGCTGCTCCGAGTGCGG - Intronic
955266477 3:57449623-57449645 CTGGCCGGCTGCTCAGAGTGCGG + Intronic
955449467 3:59050941-59050963 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
956195729 3:66651654-66651676 CCAGCCGGCTGCTCGGAGTGCGG - Intergenic
956481443 3:69677536-69677558 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
957002279 3:74900211-74900233 CCCGCCGGCGGCTCCGAGTGCGG + Intergenic
957009200 3:74985403-74985425 CCCGCCAGCTGCTCCGAGTATGG + Intergenic
957074071 3:75587881-75587903 CCGGCCAGCCGCTCCTAGTGTGG - Intergenic
957362061 3:79173420-79173442 CTGGCCAGCTGCTCGGAGTGCGG - Intronic
957386434 3:79502338-79502360 ACAGCCATCTGCTCCAAGTGCGG - Intronic
957419687 3:79951648-79951670 CCGGCCGGCTGCTCCGAGTGTGG + Intergenic
957630930 3:82715413-82715435 CGGGCCGGCTGCTCCGAGTGCGG - Intergenic
957665201 3:83217888-83217910 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
957804926 3:85134138-85134160 CCGGCCGGCTGCTCTGAGTGCGG + Intronic
957830037 3:85504953-85504975 CCGGCCGGCTGCTTCGCGTGCGG + Intronic
957921798 3:86757676-86757698 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
957995083 3:87679181-87679203 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
958810768 3:98858201-98858223 CCAGCTGGCCACTCCGAGTGTGG + Intronic
959323322 3:104906220-104906242 CCGGCTGGCTGCTCCGAATGTGG - Intergenic
959422721 3:106148710-106148732 CCAGCCGGCTGCTCTGAGTGTGG - Intergenic
960149823 3:114238567-114238589 CCGGCCGGCTGCTCCGAGTGTGG + Intergenic
960199419 3:114812931-114812953 CAGGCCGGCCGCTCCGAGTGCGG + Intronic
960227551 3:115185163-115185185 CCAGCCGGCTGCTCCCAGTGCGG + Intergenic
960276868 3:115738577-115738599 CCAGTCTGCAGCTCCCAGTGTGG - Intergenic
960282119 3:115791645-115791667 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
960479529 3:118171481-118171503 GCCGCCGGCTGCTCCAAGTGCGG - Intergenic
960560058 3:119073679-119073701 CCGGCCGGCTGCTCCAAGTGTGG + Intronic
960669187 3:120140332-120140354 CCGGCCGGCGGCTCCAAGTGCGG - Intergenic
960685486 3:120289801-120289823 CCGGCTGGCTGCTCCGAGTGCGG - Intergenic
960761690 3:121078831-121078853 CTGGCCGGCTGCTCTGAGTGCGG + Intronic
961182452 3:124887259-124887281 CCAGCGGGCTGCTCCGGGTAGGG + Exonic
961268763 3:125671760-125671782 CCAGCCAGCCGCTCCAAGTGCGG - Intergenic
961373407 3:126446521-126446543 CCAGCCAGGTGCCCCGAGAAAGG + Intronic
961460446 3:127046760-127046782 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
961465056 3:127076518-127076540 CCAGCCAGCTACTCCCAGTGCGG + Intergenic
961562436 3:127740015-127740037 CCAGCAGGCAGCTCTGAGTGGGG + Intronic
961688781 3:128653478-128653500 CCGGCCGGCCGCTCCGAGTGCGG - Intronic
961700811 3:128743199-128743221 CCAGCCGGCCACTCCGAGTGTGG + Intronic
961874386 3:130010723-130010745 CCGGCCGGCAGCTCCTAGTGCGG - Intergenic
961932332 3:130547337-130547359 CCTGCCAGCCACTCCAAGTGCGG + Intergenic
962283768 3:134070537-134070559 CTGGCTGGCTGCTCCGAGTGCGG + Intronic
962383782 3:134916637-134916659 CCAGCCGGCAGCTCTGAGTGTGG + Intronic
962600522 3:136987864-136987886 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
962758234 3:138484732-138484754 CCGGCCGGCTGCTCCGAGTGTGG - Intergenic
963397194 3:144749895-144749917 CCGGCCTGCTGCTCCCAGTGCGG - Intergenic
963440392 3:145333476-145333498 CCTGCCGGCCGCTCCGAGTGCGG - Intergenic
963509168 3:146225709-146225731 CTGGCCGACTGCTCCGAGTGTGG + Intronic
963533248 3:146497381-146497403 CCGGCCAGCTGCTCCGAGTGCGG - Intergenic
963554648 3:146772429-146772451 CCAGCCGGCCACTCTGAGTGTGG - Intergenic
963589992 3:147245843-147245865 CCGGCCGGCCGCTCCGAGTGCGG + Intergenic
963743020 3:149098127-149098149 CCAACCAGCGGCTCCAAGTGCGG + Intergenic
963760578 3:149284104-149284126 CCTGCCGGCTGCTCCCAGTGTGG - Intergenic
963862151 3:150323051-150323073 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
964014357 3:151928238-151928260 CCCGCCCGCTGCTCCGGGGGCGG - Intergenic
964037525 3:152217386-152217408 CCAGCCAGCTGCTCCGAGTGTGG - Intergenic
964265395 3:154889517-154889539 CCAGCCGGCCGCTCGGAGTGCGG + Intergenic
964393799 3:156224203-156224225 CCAGCCGGCCGCTCTGAGTGCGG + Intronic
964443985 3:156740661-156740683 CCAGCCGGCTGTTCCAAGTGCGG - Intergenic
964452159 3:156822954-156822976 CCGGCTGGCTGCTCCGAGTGCGG + Intergenic
964507601 3:157416497-157416519 TCAGCCAGCTGCTCCAGGTCAGG + Intronic
964751843 3:160060607-160060629 CCGGCCAGCTGCTCCGAATGTGG - Intergenic
964974153 3:162599781-162599803 CCGGCCAGCAGCTCCAAGTGTGG - Intergenic
964977742 3:162640153-162640175 CCGGCCGGCCACTCCGAGTGCGG - Intergenic
964982520 3:162703201-162703223 GCAGCCGGCCGCTCCGAGTGTGG + Intergenic
965003509 3:162987432-162987454 CCGGCTGGCTGCTCTGAGTGTGG - Intergenic
965040278 3:163499106-163499128 CCTGCCGGCTGCTCCCAGTACGG - Intergenic
965044154 3:163552599-163552621 CCGGCCCGCTGCTCTGAGTGCGG + Intergenic
965077977 3:164003052-164003074 CCGGCGGGCTGCTCCCAGTGCGG - Intergenic
965245259 3:166258745-166258767 CCGGCCGGCTGCTCTGAGTGCGG + Intergenic
965288025 3:166842895-166842917 CTAGCCGGCTGCCCCGAGTGCGG - Intergenic
965298113 3:166975917-166975939 CCGGCCGGCCGCTACGAGTGCGG - Intergenic
965652342 3:170947306-170947328 CCAGCCGGCCACTCCAAGTGTGG - Intergenic
965744223 3:171907327-171907349 CCCACCAGCAGCTCTGAGTGCGG + Intronic
965753250 3:171999148-171999170 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
965837352 3:172866864-172866886 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
965943503 3:174212249-174212271 CTGGCCGGCTGCTCTGAGTGCGG + Intronic
966191035 3:177272005-177272027 CCGGCCGGCTGCTCTGAGTGCGG + Intergenic
966548977 3:181183264-181183286 CCAGCCAGCTGCTTGGAGTGGGG + Intergenic
967594935 3:191317275-191317297 CCAGCCAGCTTCTCTGAGTGCGG + Intronic
968181614 3:196599314-196599336 CCCGCCAGCTGCTCCGAGTGCGG + Intergenic
968478683 4:824707-824729 CCAGGCAGCCGCTCCAGGTGGGG - Intronic
969362338 4:6672807-6672829 CCAGCCGGCTGCTCCGAGTGCGG - Intergenic
969755014 4:9143661-9143683 CCAGCGGGCTACTCTGAGTGCGG - Intergenic
970391199 4:15614997-15615019 CTGGCCGGCTGCTCTGAGTGCGG - Intronic
970574595 4:17414564-17414586 CCGGCAGGCCGCTCCGAGTGCGG + Intergenic
970615772 4:17767084-17767106 CCAGCCGGCCCCTCCGAGTGCGG + Intronic
970649345 4:18159546-18159568 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
970673184 4:18418615-18418637 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
970803508 4:20004095-20004117 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
971030766 4:22634847-22634869 CCGGCCGGGCGCTCCGAGTGCGG - Intergenic
971042979 4:22775862-22775884 CCATACAACTGCCCCGAGTGAGG + Intergenic
971043366 4:22778872-22778894 GCAGCCGGCTGTTCCGAGTGTGG + Intergenic
971066559 4:23039280-23039302 TGAGCCAGCTGCTCCCAGTGAGG - Intergenic
971209146 4:24599393-24599415 CCAGCTGGCTGCTCCAAGTATGG + Intergenic
971280549 4:25239509-25239531 CCGGCCAGCCGCTCCGACTGCGG + Intronic
971281697 4:25246892-25246914 CAGGCCGGCTGCTCCCAGTGTGG + Intronic
971553054 4:27978612-27978634 CTGGCTGGCTGCTCCGAGTGTGG + Intergenic
971563548 4:28112863-28112885 CCGGCCAGCCACTCCCAGTGCGG - Intergenic
971618745 4:28828079-28828101 CCGGTCAGCAGCTCCGAGTGTGG - Intergenic
971811938 4:31438735-31438757 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
971905211 4:32716502-32716524 CTGGCCGGCTGCTCCGAGTGAGG + Intergenic
972022800 4:34335918-34335940 CTGGCCGACTGCTCCGAGTGCGG + Intergenic
972237573 4:37151281-37151303 CCAGGCAGCTGCTTCCAGTGTGG + Intergenic
972392534 4:38626986-38627008 CCTGCCGGCTGCTCCGAGTGCGG - Intergenic
972778598 4:42266023-42266045 CTGGCCAGCTGCTCCCAGTGTGG - Intergenic
972790847 4:42369724-42369746 CCAGCCGGCTGGGACGAGTGCGG - Intergenic
972913288 4:43846253-43846275 CCAGCCGGCTGCTCCAAGTGCGG - Intergenic
973037084 4:45420246-45420268 CCTGCCGGCTGCTCCGAGTGTGG - Intergenic
973039956 4:45457392-45457414 CCGGCCGGCCGCTCTGAGTGTGG + Intergenic
973190329 4:47378331-47378353 CCGGCCGGCCGCTCCAAGTGCGG + Intronic
973587778 4:52410023-52410045 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
973764321 4:54149576-54149598 CCGGCCGGCCGCTCCAAGTGCGG + Intronic
973765111 4:54155401-54155423 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
973817565 4:54632620-54632642 CCAGCCGGTCGCTCCGTGTGCGG - Intergenic
974147401 4:57965508-57965530 CCAGCCGGCTGTTCAGGGTGGGG - Intergenic
974187998 4:58465205-58465227 CCAGCTGGCTGCTTGGAGTGTGG - Intergenic
974484806 4:62492173-62492195 CCCGCCGGCTGCTCTGAGTGCGG + Intergenic
974641759 4:64640750-64640772 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
974792785 4:66712690-66712712 CCGGCCGGCTGCTCCGCGTGTGG + Intergenic
974804367 4:66860252-66860274 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
974827740 4:67151963-67151985 CCCGCCGGCTGCTCCGAGTGCGG - Intergenic
974839356 4:67283097-67283119 CTTGCCAGCCGCTCCAAGTGTGG + Intergenic
975160688 4:71121011-71121033 CCAGCCTGCCACTCCAAGTGCGG - Intergenic
975595203 4:76043563-76043585 CTGGCCAGCTGTTCCGAGTGCGG + Intronic
975596384 4:76050934-76050956 CCGGCGGGCTGCTCCGAGTGCGG + Intronic
976102479 4:81580534-81580556 CCGGCCGGCTGCTCTGAGTGTGG - Intronic
976300910 4:83514649-83514671 CCAGCCAACTGCTCATACTGAGG + Intronic
976646881 4:87396223-87396245 CTGGCCGACTGCTCCGAGTGTGG + Intergenic
976690621 4:87863944-87863966 CTGGCCGGCTGCTCCGAGTGTGG + Intergenic
977206501 4:94169928-94169950 CCGGCCGGCGGCTCCGAGTGCGG - Intergenic
977416649 4:96742602-96742624 CCAGCTGGCCGCTCCAAGTGTGG - Intergenic
977470719 4:97438362-97438384 CCCACCAGCTGCTCTGAGTGCGG + Intronic
977606953 4:98993763-98993785 CCGGCCGGCCGCTCTGAGTGCGG + Intergenic
977750981 4:100609042-100609064 CTGGCCGGCGGCTCCGAGTGCGG + Intronic
977906466 4:102483210-102483232 CCGGCCGGCTGTTCTGAGTGCGG - Intergenic
978030580 4:103936861-103936883 CCGGCCAGCCGCTCCCAGTGGGG - Intergenic
978207208 4:106092669-106092691 CCGGCCGGCTGCTCCCAGTGCGG + Intronic
978241902 4:106525621-106525643 CCCTCCGGCTGCTCCGAGTGCGG + Intergenic
978254903 4:106681732-106681754 CCAGCTGGCTGCTCTGAGTGCGG + Intergenic
978917988 4:114148819-114148841 CCGGCCGGCCGCTCCGAGTGTGG + Intergenic
978999593 4:115200471-115200493 CCGGCAGGCTGCTCCGAGTGTGG + Intergenic
979122965 4:116926416-116926438 TCAGACAGCCGCTCCGGGTGGGG + Intergenic
979290834 4:118977326-118977348 CTGGCCAGCTGCTCCGAGTGCGG + Intronic
979308302 4:119173869-119173891 CTGGCTGGCTGCTCCGAGTGCGG - Intronic
979688569 4:123538000-123538022 CCGGCTGGCTGCTCCGAGTGCGG - Intergenic
979755855 4:124339137-124339159 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
979822544 4:125192034-125192056 CCAGCGGGCCGCTCCGAGCGCGG - Intergenic
979829339 4:125281032-125281054 CCAGTAGGCTGCTCCAAGTGCGG - Intergenic
979865202 4:125745075-125745097 CCAGCCGGCCGCTCCTAGTGTGG - Intergenic
979899726 4:126201567-126201589 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
979920443 4:126490093-126490115 CCGGCCGGCCGCTGCGAGTGCGG - Intergenic
980043398 4:127964514-127964536 CCGGCCTGCTGCTCCCAGTGCGG + Intronic
980051950 4:128047835-128047857 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
980227963 4:130012864-130012886 CTGGCCTGCTGCTCCGAGTGCGG - Intergenic
980230270 4:130038819-130038841 CCGGCCGGCTGCTCAGAGTGCGG + Intergenic
980562917 4:134501739-134501761 CCGGCTGGCTGCTCTGAGTGCGG - Intergenic
980595451 4:134948428-134948450 CCAGCTGGCTGTTCCTAGTGCGG + Intergenic
980628579 4:135406702-135406724 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
980698735 4:136395429-136395451 CCGGCCAGCTGCTCCGAGTCTGG - Intergenic
980774475 4:137421104-137421126 CCGGCCGGCCGCTCAGAGTGCGG - Intergenic
980799744 4:137733819-137733841 CGGACCAGCTGCTTCGAGTGCGG - Intergenic
981348504 4:143701056-143701078 CCAGACAGCTGGTCGGAGTCTGG - Intergenic
982024337 4:151236316-151236338 CCAGCCAGCTGTGCCAAGTGCGG - Intronic
982408209 4:155044386-155044408 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
982435094 4:155376492-155376514 CCAGGCCTCTGCTCCGAGTACGG - Intronic
982728174 4:158927785-158927807 CCCGCCGGCTGCTCCGAGTGCGG - Intronic
982768920 4:159378181-159378203 CTGGCCAGCGGCTCCAAGTGTGG - Intergenic
982770128 4:159390042-159390064 CCAGCCGGCTGCTCCGAGTGTGG - Intergenic
982868827 4:160550394-160550416 CCGGCCAGCTGCTCCGAGTGCGG + Intergenic
982921251 4:161277326-161277348 CCGGCCGGCCGCTCCCAGTGCGG - Intergenic
982985746 4:162203671-162203693 CCGGCCGGCCGCTCCCAGTGCGG - Intergenic
983026082 4:162739624-162739646 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
983060322 4:163152929-163152951 CTGGCCGGCTGCTCTGAGTGCGG - Intronic
983064101 4:163189982-163190004 CCGGCGGGCTGCTCCGAGCGCGG + Intergenic
983369781 4:166843093-166843115 CCTGCCAGCCGCTCTGAGTGCGG + Intronic
983425687 4:167581643-167581665 GCAGCCAGCCACTCTGAGTGCGG - Intergenic
983752828 4:171298358-171298380 CCGGCCTGCTGCTCCGAGTGCGG - Intergenic
984069276 4:175092195-175092217 CCAGCCGGCTGCTCCAGGTGCGG - Intergenic
984192855 4:176625441-176625463 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
984238836 4:177193472-177193494 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
984265637 4:177495675-177495697 CCGGCCGGCTGCTCCAAGTGTGG - Intergenic
984662234 4:182386644-182386666 CCGGCCGGCAGCTCCGAGTGCGG - Intronic
984901733 4:184591992-184592014 CCGGCCGGCCGCTCCGAGTGTGG - Intergenic
984948739 4:184990365-184990387 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
985087081 4:186324667-186324689 CCGGCCGGCTGCTCCGAGTGTGG - Intergenic
985195192 4:187421225-187421247 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
985324693 4:188754582-188754604 CCAGCCGGCCACTCCAAGTGTGG - Intergenic
985366384 4:189236391-189236413 GCCGCCAGCTGCTGCGAGTGTGG - Intergenic
985403616 4:189615494-189615516 CCGGCCAGCCACTCCGAGTGTGG + Intergenic
985409179 4:189665014-189665036 CTGGCCAGTCGCTCCGAGTGCGG + Intergenic
985592083 5:770841-770863 CCAGCCACCTGCTCTGGGGGCGG - Intergenic
986151985 5:5137869-5137891 CTGGCCGGCTGCTCTGAGTGCGG - Intergenic
986626147 5:9725392-9725414 CCAGCCGGCTGCTCCAAGTGCGG - Intergenic
986661728 5:10065573-10065595 CCGGCCGGCCGCTCAGAGTGGGG - Intergenic
986726599 5:10602596-10602618 CCAGCCAGCTGCTCTGAGGCAGG - Intronic
986912403 5:12574221-12574243 CCAGCCGGCCGCTCCGAGTGCGG + Intergenic
987099161 5:14577331-14577353 CTGGCCGGCCGCTCCGAGTGTGG - Intergenic
987146267 5:14994082-14994104 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
987156806 5:15096832-15096854 TCGGCCGGCTGCTCCGAGTGCGG + Intergenic
987315278 5:16718035-16718057 CTGGCTGGCTGCTCCGAGTGCGG - Intronic
987347445 5:16991215-16991237 CCGGCCTGCCGCTCGGAGTGCGG + Intergenic
987355842 5:17062314-17062336 CTAGCCGGCCGCTCTGAGTGAGG - Intergenic
987358207 5:17083543-17083565 CCGGCGGGCTGCTCCGAGTGCGG - Intronic
987384029 5:17312049-17312071 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
987476714 5:18399949-18399971 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
987876933 5:23691208-23691230 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
988035594 5:25823595-25823617 CCAGCTGGCCACTCCGAGTGTGG + Intergenic
988073474 5:26324505-26324527 CCCGCCGGCTGCTCCGAGTGCGG - Intergenic
988087007 5:26485557-26485579 CCGGCCGGCTGCTCAGAGTGCGG + Intergenic
988132143 5:27119982-27120004 CTGGCCGGCTGCTCCGAGTGCGG - Intronic
988201792 5:28077928-28077950 CCGGCTGGCTGCTCCGAGTGTGG + Intergenic
988369225 5:30345812-30345834 CCGGTCAGCTGCTCCTAGTGCGG - Intergenic
988500117 5:31777186-31777208 CCTGCCAGCCACTCCGAGTGCGG - Intronic
988684750 5:33515663-33515685 CCGGCCCGCTGCTCCGAGTGTGG + Intergenic
988755618 5:34245090-34245112 CCAGCCGACCGCTCAGAGTGCGG + Intergenic
988883571 5:35531710-35531732 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
989003185 5:36782665-36782687 CCGGCGGGCTGCTCCAAGTGCGG - Intergenic
989346781 5:40438743-40438765 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
989757644 5:44975096-44975118 CTGACCAGCTGCGCCGAGTGTGG - Intergenic
989957913 5:50376916-50376938 CTGGCTGGCTGCTCCGAGTGTGG - Intergenic
990243244 5:53837055-53837077 CCAGCCAGCTGCTCCGAGTGCGG - Intergenic
990461508 5:56035573-56035595 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
990512167 5:56498934-56498956 CCGGGAAGCTGCTCTGAGTGTGG + Intergenic
990869463 5:60415539-60415561 CCGGCCTGCCGCTCCCAGTGCGG - Intronic
991505407 5:67318946-67318968 CCAGCTGGCAGCTCCAAGTGTGG - Intergenic
991567584 5:68020679-68020701 CCGGCCGGCGGCTCCGAGTGCGG + Intergenic
991657779 5:68920952-68920974 CCGGCCGGCTGCTCTGAGTGCGG - Intergenic
992296724 5:75333769-75333791 CTGGCTGGCTGCTCCGAGTGTGG - Intergenic
992525455 5:77605665-77605687 CCAGCCAGCTGCTGTGTCTGTGG - Intronic
993320948 5:86466957-86466979 CCGCCCGGCTGCTCCGAGTGCGG + Intergenic
993328596 5:86569800-86569822 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
993752258 5:91684769-91684791 GCAGCCTGCTTCTCAGAGTGAGG - Intergenic
993822017 5:92631417-92631439 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
994239857 5:97407262-97407284 CGGGCCGGCGGCTCCGAGTGCGG - Intergenic
994251535 5:97542156-97542178 CCAGCCGGCTGCTCCGAGTGTGG + Intergenic
994254807 5:97580270-97580292 CCGGCCAGCTGCTCTGAGTGTGG + Intergenic
994507094 5:100656847-100656869 CCAGCCGGCTGCTCTGAGTGTGG - Intergenic
994509857 5:100689144-100689166 CCAGCCAGCTGCTCCGAGTGCGG + Intergenic
994570283 5:101506111-101506133 CCGGCCGGCTGCTCTAAGTGCGG - Intergenic
994605617 5:101962722-101962744 CTGGCCGGCTGCTCCCAGTGCGG + Intergenic
994669737 5:102752150-102752172 CCGGCCGGCCACTCCGAGTGTGG - Intergenic
994701714 5:103142307-103142329 CTGGCCGGCTGCTCCGAGTGCGG + Intronic
994769804 5:103966602-103966624 CTGGCCAGCTGCTCCGAGTGGGG + Intergenic
994841376 5:104929087-104929109 CCGGCCAGGTGCTCCGAGTGCGG - Intergenic
994900128 5:105760594-105760616 CCAGGCTGCTGGTCGGAGTGGGG - Intergenic
995326419 5:110894259-110894281 CCAGCCGGCGGCTCCGAGTGCGG + Intergenic
995529118 5:113075119-113075141 CCAGCCGGCTGCTCCAAGTGCGG - Intronic
995568662 5:113457228-113457250 CCAGCCAGCTGCTCCGAGTGTGG - Intronic
995582621 5:113617399-113617421 CCAGCCAGCCACTCCAAGTGTGG - Intergenic
995679885 5:114704565-114704587 CTGGCCGGCTGCTCCCAGTGCGG + Intergenic
995700347 5:114928920-114928942 CCAGCTGGCTGCTCCAAGTGTGG - Intergenic
995920382 5:117304745-117304767 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
995975794 5:118033863-118033885 CCAGCCAGCTGCTCCGAGTGCGG - Intergenic
996435675 5:123430631-123430653 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
996747114 5:126854806-126854828 CAGGCCGGCTGCTCGGAGTGCGG + Intergenic
997158212 5:131580310-131580332 CCAGCCGGTCACTCCGAGTGTGG + Intronic
997760544 5:136444297-136444319 CCCGCCGGCTGCTCCGAGTGTGG - Intergenic
998117522 5:139549428-139549450 CCAGCCGGCCGCTCGGAGTGCGG - Intronic
999406165 5:151309276-151309298 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
999855301 5:155587028-155587050 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1000041170 5:157486331-157486353 GGAGGCAGCTGCTCTGAGTGGGG - Intronic
1000066018 5:157693922-157693944 CCGGCCGGCTGCTCCCAGTGAGG - Intergenic
1000084728 5:157879374-157879396 CCAGCTGGCAGCTCTGAGTGCGG - Intergenic
1000329207 5:160194173-160194195 CCGGCCGGCTGCTCCCAGTGCGG + Intronic
1000547595 5:162621927-162621949 CCAGCCGGCTGCTCCGAGTGTGG - Intergenic
1000609129 5:163355941-163355963 CCAGCTGGCTGCTCCGAGTGCGG - Intergenic
1001636431 5:173213529-173213551 CCGGCCGGCCGCTCAGAGTGTGG - Intergenic
1001841527 5:174880752-174880774 CCGGCCGGCAGCTCTGAGTGCGG - Intergenic
1002004653 5:176222301-176222323 CCGGCTGGCTGCTCGGAGTGCGG + Intergenic
1002221725 5:177688319-177688341 CCGGCCGGCTGCTCCAAGTGCGG - Intergenic
1002414795 5:179114381-179114403 CCAGCAAGCTGCACCCTGTGGGG - Intronic
1002789393 6:426477-426499 CCGGCCTGATGCTCCGAGTGCGG + Intergenic
1002907040 6:1457247-1457269 CCGGCCTGATGCTCCGAGTGCGG + Intergenic
1003069654 6:2935892-2935914 CCGGCCGGCGGCTCCGAGTGCGG - Intergenic
1003070207 6:2939714-2939736 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1003081897 6:3027786-3027808 CCGCCCGGCTGCTCTGAGTGCGG - Intergenic
1003100174 6:3170850-3170872 CCGGCTGGCTGCTCCGAGTGCGG - Intergenic
1003111256 6:3253655-3253677 CCGGCCGGTTGCTCCGAGCGCGG - Intronic
1003170863 6:3721041-3721063 CTGGCCGGCTGCTCCCAGTGCGG + Intergenic
1003176858 6:3758248-3758270 CCTGCTGGCCGCTCCGAGTGCGG - Intergenic
1003178471 6:3771721-3771743 CCAGCCAGCCGCTCCGAGTGCGG - Intergenic
1003224481 6:4191565-4191587 CCAGCCGGCTGCTCGGAGTGTGG + Intergenic
1003490039 6:6613524-6613546 CAGGCCGGCCGCTCCGAGTGCGG + Intronic
1003508852 6:6762756-6762778 CTGGCCGGCTGCTCCAAGTGCGG + Intergenic
1003531358 6:6940176-6940198 TCGGCCGGCCGCTCCGAGTGCGG - Intergenic
1003578304 6:7317010-7317032 CCCGCTGGCCGCTCCGAGTGCGG + Intronic
1003581428 6:7344301-7344323 CCGGCTGGCTGCTCCGAGTGCGG - Intronic
1003589592 6:7425866-7425888 CCAGCTGGCTGCTCCGAGTGCGG - Intergenic
1003593701 6:7456444-7456466 CCAGCCGGCCGCTCTGAGTGAGG - Intergenic
1003644043 6:7899922-7899944 CCAGCCCGCTGCTGTGACTGAGG + Intronic
1003671523 6:8164421-8164443 AGGGCCGGCTGCTCCGAGTGCGG - Intergenic
1003736881 6:8887251-8887273 GCTGGCTGCTGCTCCGAGTGCGG - Intergenic
1003749566 6:9040843-9040865 CCGGCCTGCCGCTCCGAGTGCGG - Intergenic
1003770173 6:9290712-9290734 AGGGCCGGCTGCTCCGAGTGCGG + Intergenic
1003836225 6:10074954-10074976 CTAACCAGCCGCTCCGAGTGCGG + Intronic
1003845715 6:10171807-10171829 CTCGCCGGCTGCTCTGAGTGCGG - Intronic
1003862775 6:10337495-10337517 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
1003874178 6:10422217-10422239 AGAGCCAGCTGCTCTCAGTGCGG + Intergenic
1003908113 6:10720678-10720700 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1003947265 6:11087301-11087323 ACGGCCGGCTGCTCCGAGTGCGG - Intergenic
1003982483 6:11402858-11402880 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1004036950 6:11933165-11933187 CTGGCCGGCTGCTCCGAGTGTGG - Intergenic
1004053168 6:12108666-12108688 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
1004200249 6:13541625-13541647 CCGGCTGGCCGCTCCGAGTGCGG - Intergenic
1004217570 6:13716835-13716857 CCAGGCGGCCGCTCCGAGTGCGG - Intergenic
1004220595 6:13743285-13743307 CCGGCCGGCTGCTCCTAGTGCGG - Intergenic
1004224383 6:13772574-13772596 CCGGCCGGCTGCTGCGAGTGCGG - Intergenic
1004234250 6:13860218-13860240 CCAGCCAGCCACTCCGAGTGCGG - Intergenic
1004235556 6:13872198-13872220 CTGGCCGGCTGCTCCCAGTGCGG + Intergenic
1004250304 6:14018119-14018141 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
1004354055 6:14916067-14916089 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
1004499687 6:16198367-16198389 CGGGCCGGCTGCTCCCAGTGCGG + Intergenic
1004503222 6:16227172-16227194 CCGGCCAGGCGCTCCGAGTGCGG + Intergenic
1004665541 6:17745583-17745605 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1004689109 6:17976464-17976486 CCGGCTGGCTGCTCCGAATGCGG + Intronic
1004690200 6:17987204-17987226 CCCGCCAGCCGCGCCGAGCGGGG + Intronic
1004693318 6:18011465-18011487 TCGGCCGGCCGCTCCGAGTGCGG + Intergenic
1004866072 6:19854703-19854725 CCGGCCGGTTGCTCCGAGTGCGG + Intergenic
1004906198 6:20239147-20239169 CCGGCCGGCCGCTCCGACTGTGG - Intergenic
1004906950 6:20245047-20245069 CTGGCCGGCGGCTCCGAGTGCGG + Intergenic
1004912615 6:20301337-20301359 CCGGCGGACTGCTCCGAGTGCGG - Intergenic
1004914436 6:20319003-20319025 TATGCCAGCCGCTCCGAGTGCGG - Intergenic
1005035587 6:21552560-21552582 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1005114294 6:22318681-22318703 GCTGGCAGCTGCTCTGAGTGCGG + Intergenic
1005332896 6:24766212-24766234 CTGGCTGGCTGCTCCGAGTGTGG + Intergenic
1005554256 6:26956865-26956887 CCAGCCGACCGCTCAGAGTGCGG + Intergenic
1005596225 6:27381334-27381356 GCCGGCAGGTGCTCCGAGTGCGG + Intronic
1005600890 6:27425104-27425126 CCGGCCGGCTGCTCCGAGCGCGG + Intergenic
1005707461 6:28469629-28469651 CCGGCCGGTTGCTCCGAGTGCGG + Intergenic
1005712006 6:28511923-28511945 CCGGCTGGCCGCTCCGAGTGCGG - Intronic
1005749947 6:28872869-28872891 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1005759791 6:28957929-28957951 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1005766302 6:29015179-29015201 CCGGCCGGCCGCTCCGAGTGTGG - Intergenic
1005870592 6:29971975-29971997 CCACCCAGCAGTTCCAAGTGAGG + Intergenic
1005977021 6:30807718-30807740 CTGGCCGGCTGCTCTGAGTGCGG + Intergenic
1005978255 6:30816574-30816596 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1006007811 6:31016876-31016898 CCAGCCCGAGGCTCAGAGTGTGG - Intronic
1006008287 6:31020804-31020826 CCCGCTGGCTGCTTCGAGTGCGG - Intronic
1006033622 6:31195545-31195567 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
1006127952 6:31852140-31852162 CCAGCCTGCCGCTCCAAGAGCGG - Intergenic
1006227082 6:32548200-32548222 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1006351117 6:33521775-33521797 CCAGCCGGCTGCTCCGAGTGTGG + Intergenic
1006352625 6:33532474-33532496 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1006434145 6:34017458-34017480 CCAGCCGGCGGCTCCCAGTGCGG + Intergenic
1006477815 6:34269110-34269132 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1006748917 6:36364508-36364530 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
1007738719 6:43998182-43998204 CTGGCGGGCTGCTCCGAGTGCGG - Intergenic
1008005608 6:46406042-46406064 CCGGCCGGCTGCTCCGAATGCGG + Intronic
1008038766 6:46774683-46774705 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1008230883 6:48984028-48984050 CCAGCTGGCGGCTCCGAGTGTGG - Intergenic
1008270203 6:49482100-49482122 CCAGCCAGCTGCTCCGAGTGTGG + Intronic
1008270507 6:49483693-49483715 CCAGCCAGCTGCTCCAAGTGTGG + Intronic
1008284361 6:49629825-49629847 CCAGCCGGCTGCTCCGAGTGCGG + Intronic
1008567820 6:52786599-52786621 CCGGCCAGCCACTCTGAGTGTGG - Intergenic
1008844821 6:55950394-55950416 CCAGCAAGCTGTTCAGAGTGCGG - Intergenic
1009471404 6:64031241-64031263 CCGGCCAGCCCCTCTGAGTGCGG - Intronic
1009587639 6:65627626-65627648 CTGGCCAGCTGTTCCGAGTGTGG - Intronic
1009685320 6:66949299-66949321 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1010199330 6:73269150-73269172 CCGGCCGGCTGCTCCGAGTATGG + Intronic
1010235666 6:73572812-73572834 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1010269329 6:73903243-73903265 CCAGCCAGCTGCTCCGAGTGTGG - Intergenic
1010617366 6:78029883-78029905 CCGGCCGGCCGCTCCGAGTGCGG - Intergenic
1011143676 6:84189452-84189474 CTGGCTGGCTGCTCCGAGTGCGG - Intronic
1011620104 6:89234722-89234744 CCAGCCGGCCGCTCCGAGTGCGG + Intergenic
1012189357 6:96261221-96261243 CCGGCCGGCTGCTCCGAGAGCGG + Intergenic
1012632222 6:101485274-101485296 CTAGCCAGCTGCTTCATGTGAGG - Intronic
1012733548 6:102910918-102910940 CCCGCCGGCCTCTCCGAGTGCGG + Intergenic
1012789686 6:103677391-103677413 CCAGCCAGCTGCACCGAGTGTGG + Intergenic
1013025738 6:106269682-106269704 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
1013081502 6:106817038-106817060 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1013143584 6:107364521-107364543 CTGGCTGGCTGCTCCGAGTGCGG + Intronic
1013694816 6:112689599-112689621 CCCGCCGGCCGCTCCTAGTGCGG + Intergenic
1013853353 6:114541959-114541981 CCGGCTGGCTGCTCCAAGTGAGG + Intergenic
1013955361 6:115834876-115834898 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1014088393 6:117373562-117373584 CTGGCCAGCCGCTCTGAGTGCGG + Intronic
1014240724 6:119015408-119015430 CCGGCCGGCCGCTCTGAGTGTGG - Intronic
1014280795 6:119441084-119441106 CCAGCCGGCCGCTCCGAGTGCGG - Intergenic
1014718548 6:124892057-124892079 CTGGCCGACTGCTCCGAGTGTGG - Intergenic
1014882691 6:126743207-126743229 CCAGGCAGATTCTCCCAGTGTGG + Intergenic
1015572270 6:134633821-134633843 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1015600330 6:134904815-134904837 CCGGTCGGCTGCTCCGAGTGCGG - Intergenic
1015937836 6:138420478-138420500 CCATCCAGCTGCAAGGAGTGTGG + Exonic
1016067386 6:139698191-139698213 CCAGCCGGCTGCTCCGAGTGCGG + Intergenic
1016069903 6:139726624-139726646 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1016092847 6:139999860-139999882 CCCGCCGGCTGCTCCGAGTGCGG + Intergenic
1016104746 6:140148397-140148419 CGGGCCAGCTGCTCCGAGTGAGG + Intergenic
1016183514 6:141175181-141175203 CCAGCCAGCTGCGCTGAGTCTGG - Intergenic
1016482334 6:144495425-144495447 CCAGCCTGCTGCTCCGAGTGCGG + Intronic
1016811410 6:148264722-148264744 GAGGCCAGCTGCTCTGAGTGTGG - Intergenic
1016858934 6:148698320-148698342 CCCACCGGCTGCTCCAAGTGCGG + Intergenic
1017298968 6:152834428-152834450 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
1017325071 6:153133706-153133728 CCTGCCGGCTGCTCCGAGTGCGG - Intergenic
1017383534 6:153857215-153857237 CCAGCCAGCTGCTCTGAGTGCGG + Intergenic
1017537354 6:155363153-155363175 CTGGCCGGCTGCTCCGAGTGCGG - Intergenic
1017581239 6:155867031-155867053 CCGGCCGGCTGCTCCAAGTGCGG + Intergenic
1017784310 6:157742212-157742234 CCAGCCAGCATCTGAGAGTGAGG + Intronic
1017839526 6:158210064-158210086 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1018064256 6:160114777-160114799 CCGGCCGGCTGCTCTGAGTGCGG + Intergenic
1018427198 6:163694219-163694241 CCAGCCACCTCCTCCCTGTGAGG - Intergenic
1018545659 6:164933383-164933405 CCAGCCAGCTGCTCCCAGTGCGG - Intergenic
1018624663 6:165765562-165765584 CCGGCTGGCTGCTCCGAGTGCGG + Intronic
1018700541 6:166422684-166422706 CCTGCTAGCTGCTCCGAGCGGGG + Intronic
1019000281 6:168744061-168744083 CCGGCTGGCTGCTCCGAGTGCGG + Intergenic
1019086210 6:169480120-169480142 CCGGCTGGCTGCTCCAAGTGTGG - Intronic
1019618368 7:1977392-1977414 CTGGCCAGCTGCTCGGAGTGTGG + Intronic
1020008270 7:4793612-4793634 CTAGCCGGCGGCTCCGAGTGCGG - Intronic
1020375363 7:7478820-7478842 CCAGTCGGCTGCTCCAAGTGCGG + Intronic
1021065769 7:16170847-16170869 GCCGGCAGCCGCTCCGAGTGTGG + Intronic
1021324107 7:19245568-19245590 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1021567374 7:22028763-22028785 CCGGCCAGCCGCTCCGAGTGTGG - Intergenic
1021686778 7:23194003-23194025 CCAGCCGGCAGCTCTGAGTGTGG + Intronic
1022750420 7:33219058-33219080 CTGGCCGGCTGCTCCGAGTGCGG - Intronic
1023127924 7:36973826-36973848 AGGGCCGGCTGCTCCGAGTGCGG - Intronic
1023396219 7:39754215-39754237 CCGGCCCGCCGCTCCGAGTGCGG + Intergenic
1023767896 7:43529071-43529093 CCAGCCACCTGCTCCCACAGTGG + Intronic
1024269059 7:47628561-47628583 CCGGCCGGCTGCTCCGGGTGCGG - Intergenic
1024335654 7:48203189-48203211 CCGGCCGGCTGCTCCGAGTGCGG + Intronic
1024691260 7:51805919-51805941 CCGGCCTGCTGCTCCGAGTGCGG - Intergenic
1024825440 7:53385438-53385460 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1024834028 7:53495105-53495127 CCGGCCGGCTGCTCTGAGTGCGG - Intergenic
1025962088 7:66231616-66231638 CCAGCCAGCTGCTCCGAGTGCGG + Intronic
1026187106 7:68090690-68090712 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1026202929 7:68231115-68231137 CCAGCTGGCTGCTCCGAGTGCGG - Intergenic
1026335880 7:69393911-69393933 CCGGCCGGCTGCTCTGAGTGCGG - Intergenic
1026516549 7:71078073-71078095 CCGGCCTGCTGCTCCCAGTGTGG - Intergenic
1026596575 7:71738355-71738377 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1027238026 7:76309713-76309735 CCGGCCGGCTGCTCCAAGTGCGG + Intergenic
1027476680 7:78640671-78640693 CCAGCCAGTTGCTCCCCGTGAGG - Intronic
1027561652 7:79739384-79739406 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1027564057 7:79768240-79768262 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1027579732 7:79977879-79977901 CCGGCCGGCAGCTCTGAGTGCGG + Intergenic
1027665876 7:81042792-81042814 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1027674454 7:81141822-81141844 CCGGCCGGCCGCTCAGAGTGTGG - Intergenic
1027868081 7:83673402-83673424 CCAGCCGGCCGCTCCGAGTGCGG - Intergenic
1028070075 7:86440651-86440673 CCGGCCGGCTGCTCCGGGGGCGG - Intergenic
1028303308 7:89229004-89229026 CCGGCCGGCTGCTCCGAGTGTGG + Intronic
1028392650 7:90334504-90334526 CCGGCTGGCTGCTCCGAGTGCGG - Intergenic
1028511237 7:91627669-91627691 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1028558047 7:92143602-92143624 CTGGCCGGCCGCTCCGAGTGCGG + Intronic
1028852537 7:95552742-95552764 CCGGCCGGCCGCTCCGAGTGTGG + Intergenic
1028857192 7:95605490-95605512 CGAGCCGGCTGCTCCGAGTGCGG - Intergenic
1028989489 7:97034423-97034445 CCCCCCAACCGCTCCGAGTGCGG - Intergenic
1029065361 7:97843142-97843164 CCAGCCGGCTGCTCAGAGTGCGG + Intergenic
1029076137 7:97936013-97936035 CCAGCCGGCAGCTCCTAGTGCGG - Intergenic
1029407076 7:100381812-100381834 CCGGCCGGCCACTCCGAGTGCGG - Intronic
1030102133 7:105956033-105956055 CCGGCGGACTGCTCCGAGTGCGG + Intronic
1030215736 7:107042594-107042616 CCGGCCGGCCGCTCCGAGTGCGG + Intergenic
1030367029 7:108657493-108657515 CCCGCCGGCCGCTCCGAGTGCGG + Intergenic
1030600000 7:111582219-111582241 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1030733463 7:113017427-113017449 CCTGCCGGCTGCTCCGAGTGCGG - Intergenic
1030772241 7:113488421-113488443 CCGGCCAGCTGCTCCGAGTGTGG + Intergenic
1030780396 7:113593403-113593425 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1030819331 7:114077119-114077141 CCGGCTGGCTGCTCCGAGTGCGG + Intergenic
1031109958 7:117596229-117596251 CCGGCCGGCTGCTCCGAGTGCGG - Intronic
1031292274 7:119951787-119951809 CTGGTCGGCTGCTCCGAGTGCGG + Intergenic
1031902849 7:127429250-127429272 CCAGCCGGCCGCTCCAAGTATGG - Intronic
1032019020 7:128396386-128396408 GCAGCCTGCTTCTCAGAGTGCGG - Intronic
1032274214 7:130440553-130440575 CCAGCCAGCATCTCTGATTGTGG - Intronic
1032339634 7:131058847-131058869 CCAGACAGCTGCTCCGAGTGCGG - Intergenic
1032437103 7:131909411-131909433 CCGGCCGGCCCCTCCGAGTGCGG - Intergenic
1033065070 7:138146248-138146270 CCAGCTGGCCGCTCCGAGTGAGG - Intergenic
1033305538 7:140222870-140222892 CCAGCCAGCTGCCCTGACAGTGG - Intergenic
1033312439 7:140271581-140271603 CCGGCCGGCCCCTCCGAGTGCGG + Intergenic
1033394102 7:140957221-140957243 CCGGCGAGTTGCTCCGAGTGAGG + Intergenic
1033664120 7:143424673-143424695 CCGGCCGGCCGCTCCGAGTGCGG + Intergenic
1033839941 7:145360912-145360934 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1033866652 7:145697645-145697667 CCGGCCGGCCGCTCCAAGTGCGG + Intergenic
1034097893 7:148426492-148426514 CCGGCTGGCTGCTCCGAGTGCGG - Intergenic
1034100372 7:148445501-148445523 CCCGCTGGCGGCTCCGAGTGTGG + Intergenic
1034155000 7:148949165-148949187 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1034167773 7:149038974-149038996 CTAGCCGACTGCTGCGAGTGCGG + Intergenic
1034492703 7:151402498-151402520 CCAGCCAGCCGCTGCCAGTGGGG - Intronic
1034656059 7:152730552-152730574 CTGGCCGGTTGCTCCGAGTGCGG + Intergenic
1035151202 7:156874280-156874302 CCGGCTGGCTGCTCCGAGTGCGG + Intronic
1035261656 7:157665463-157665485 CCGTCCAGCTCCTCAGAGTGGGG - Intronic
1035463918 7:159063416-159063438 CCGGCCGGCCGCTCCAAGTGCGG + Intronic
1035734874 8:1880946-1880968 CCAGCCAGATGCTGCATGTGAGG - Intronic
1035833898 8:2727919-2727941 CCGGCCTGCCGCTCCGAGTGGGG - Intergenic
1035999227 8:4582911-4582933 CCGGCCAGCTGCTCCGAGTGTGG - Intronic
1036441051 8:8781668-8781690 CCGGCCGGCTGCTCCTAGTGCGG + Intergenic
1036711121 8:11079116-11079138 CTAGCCACCTGCTCCCAGGGAGG + Intronic
1036914960 8:12796379-12796401 CCGGCCAGCTGCTGCGAGTGCGG - Intergenic
1036928668 8:12931581-12931603 CCGGCCGGCCGCTCCGAGTGCGG + Intergenic
1036952533 8:13154474-13154496 CCGGCCAGCTGCTCCGAGTGCGG + Intronic
1037064997 8:14566910-14566932 CCAGCCGGCCGCTCTGAGTGTGG - Intronic
1037239520 8:16760786-16760808 GCAGCCAGCTGCTCCCAGTGTGG + Intergenic
1037241534 8:16783990-16784012 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1037263860 8:17037094-17037116 CTGGCCGGCTGCTCCGACTGCGG + Intronic
1037417592 8:18667960-18667982 CCGGCCGGCCGCTCCAAGTGTGG + Intronic
1037810956 8:22086638-22086660 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1037971359 8:23174078-23174100 CTGGCCGACTGCTCCGAGTGCGG + Intergenic
1038174053 8:25164580-25164602 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1038638262 8:29304337-29304359 CCGGCCGGCTGCTCCGAGTGTGG - Intergenic
1038639387 8:29311549-29311571 CCAGCCAGCTGCTCCGAGTGTGG - Intergenic
1039068717 8:33631761-33631783 CTGGTCGGCTGCTCCGAGTGCGG - Intergenic
1039637283 8:39180198-39180220 CCGGCCCGCTGCTCCGAGTGCGG - Intronic
1039926078 8:41933407-41933429 CCACACAGCTGCTCTGGGTGAGG + Exonic
1040014437 8:42689577-42689599 CCAGCCGGCCGCTCCCAGTGCGG - Intergenic
1040027679 8:42796687-42796709 CTGGCCGGCTGCTCTGAGTGCGG - Intergenic
1040583431 8:48716262-48716284 CCAGCCGGCCGCTCCAAGTGCGG + Intronic
1040952721 8:52953133-52953155 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1040953989 8:52961477-52961499 CCGGCCGGCCGCTCTGAGTGCGG - Intergenic
1040954940 8:52970124-52970146 CCGGCCAGCTGCTCCTAGTGCGG + Intergenic
1040965590 8:53077904-53077926 CCAGCCAGCTGCTCCAAGTGTGG + Intergenic
1040988542 8:53323504-53323526 CTAGGCAGCTGCTATGAGTGAGG + Intergenic
1041034675 8:53776175-53776197 CCGGCCGGCTGCTCCGAGTTTGG + Intronic
1041292356 8:56319767-56319789 CCTGCCCTCTGCTCCGGGTGGGG + Intronic
1041914512 8:63126193-63126215 CAGGCCAGCTGCTCCGAGTGCGG - Intergenic
1042948773 8:74179793-74179815 GGGGCCAGCGGCTCCGAGTGCGG + Intergenic
1043073367 8:75665741-75665763 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1043102238 8:76060683-76060705 CCGGCCGGCTTCTCCAAGTGTGG + Intergenic
1043129957 8:76447890-76447912 CCGGCGGGCCGCTCCGAGTGCGG + Intergenic
1043346443 8:79303578-79303600 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1043352507 8:79377481-79377503 CCGGCTGGCTGCTCCGAGTGCGG + Intergenic
1043435306 8:80231892-80231914 CCGGCCGGCCGCTCCGAGCGCGG - Intergenic
1043621046 8:82192527-82192549 CCCGCCGGCCGCTCCGAGTGTGG + Intergenic
1043640151 8:82441505-82441527 CCGGCCTGCGGCTCTGAGTGCGG - Intergenic
1043701110 8:83290436-83290458 CCAGCCGGCCGCTCCGAGTGCGG - Intergenic
1043709861 8:83403022-83403044 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1043857147 8:85276146-85276168 CCGGCCCGCCGCTCCGAGTGCGG - Intronic
1044075806 8:87820918-87820940 CCAGCCGGCTGCTCCGAGTGCGG - Intergenic
1044088473 8:87971231-87971253 CCGGCCAGCCACTCCGAGTGCGG - Intergenic
1044404879 8:91816447-91816469 CCAGCCGGCCACTCCGAGTGCGG - Intergenic
1044633493 8:94300610-94300632 CCGGCCGGCTTCTCCGAGTGCGG + Intergenic
1044788665 8:95823722-95823744 TCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1044880680 8:96719363-96719385 CTGGCCGGCTGCTCCAAGTGCGG + Intronic
1045306036 8:100957386-100957408 CCGGCCAGCTGCGCCAAGTGCGG + Intergenic
1045407403 8:101880275-101880297 CTGGCCAGCCGCTCGGAGTGCGG + Intronic
1045467779 8:102485788-102485810 CAGGCCAGCTGCTCCGAGTGCGG + Intergenic
1046149366 8:110202847-110202869 CCTGCCGGCTGCTCCGAGTGCGG + Intergenic
1046208908 8:111041114-111041136 CCGGCCGGCCGCTCGGAGTGCGG + Intergenic
1046288885 8:112132775-112132797 CCTGCCGGCTGCTCTGAGTGCGG - Intergenic
1046445318 8:114311435-114311457 CCGGTCGGCTGCTCCCAGTGCGG - Intergenic
1046661215 8:116950012-116950034 CCGGCCGGCGGCTCCGAGTGCGG + Intergenic
1047423135 8:124723843-124723865 TCAGCCAGGTGCTCTGAGGGAGG - Intronic
1047631723 8:126714913-126714935 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1047951583 8:129939777-129939799 CCAGGCGGCAGCTCCGAGCGGGG + Exonic
1048655426 8:136530687-136530709 CCGGCAGGCCGCTCCGAGTGCGG + Intergenic
1048676979 8:136794067-136794089 CCGGCCGGCCGCTCCGAGTGCGG + Intergenic
1048757519 8:137755397-137755419 CCGGCCGGCTGCTCCCAGTGCGG + Intergenic
1048789154 8:138084219-138084241 CCGGCCGGCTGCTCCAAGTGCGG - Intergenic
1048981162 8:139703902-139703924 CCAGCCCGCTCCTCCGGGGGCGG + Intergenic
1049087657 8:140490791-140490813 CCGGCCGGCTGCTCCGAGTGTGG + Intergenic
1049500294 8:142959560-142959582 CCGGCCGTCTGCTCCGAGTGCGG - Intergenic
1049509958 8:143022407-143022429 CCAGCTTCCTGCTCTGAGTGTGG + Exonic
1049530153 8:143150229-143150251 TCAGCTAGCTGCTGCGTGTGGGG - Intergenic
1049857923 8:144875254-144875276 CCGGCCAGCAGCTCCGAGCGCGG - Intergenic
1050249939 9:3733895-3733917 CTGGTCGGCTGCTCCGAGTGCGG - Intergenic
1050610848 9:7351182-7351204 CCACCAAGCTGCTCTGAGAGAGG + Intergenic
1050891990 9:10836039-10836061 CTGGCCAGCCGCTCCGAGTGTGG - Intergenic
1051305109 9:15700318-15700340 CCGGCCGGCTGCTCTGAGTGTGG + Intronic
1051314210 9:15810680-15810702 CCGGCTGGCTGCTCCGAGTGCGG + Intronic
1051383286 9:16480592-16480614 CCGGCCTGCTGCTCCAAGTGTGG - Intronic
1051439841 9:17072689-17072711 CCAGCCTGCTGCTCCAAGTGTGG - Intergenic
1051463781 9:17354018-17354040 CTGGTCGGCTGCTCCGAGTGCGG - Intronic
1051485706 9:17605602-17605624 CCAGGCAGCTCCTCAGTGTGGGG + Intronic
1052075436 9:24135169-24135191 GCGGCCCGCTGCTCTGAGTGCGG - Intergenic
1052122775 9:24738611-24738633 CCGGCCAGCAGCTCCAACTGTGG - Intergenic
1052979528 9:34438008-34438030 CCAGCCGGCTGCTCCGAGTGCGG - Intronic
1052985367 9:34483041-34483063 CTGGCTGGCTGCTCCGAGTGCGG + Intronic
1053812054 9:41862675-41862697 CTGGCCGGCTGCTCCCAGTGTGG + Intergenic
1054618541 9:67324764-67324786 CTGGCCGGCTGCTCCCAGTGTGG - Intergenic
1054722429 9:68617107-68617129 CCGGCGGGCTGCTCCGAGTGTGG - Intergenic
1055557596 9:77490659-77490681 CCGGCCGGCCGCTCCGAGTGCGG + Intronic
1055654917 9:78442154-78442176 CCGGCCAGCCGCTCCCAGTGCGG - Intergenic
1055985527 9:82054611-82054633 CCAGCTGGCTGCTCCGAGTGCGG + Intergenic
1056080984 9:83093583-83093605 CCGGTCGGCTGCTCCGAGTGTGG + Intergenic
1056305745 9:85289129-85289151 CTGGCCAGCCGCTCCGAGTGTGG - Intergenic
1056735926 9:89209486-89209508 CCAGCTGGCCGCTCCAAGTGCGG - Intergenic
1056771415 9:89480695-89480717 CTGGCTGGCTGCTCCGAGTGCGG + Intronic
1057210448 9:93198396-93198418 CCATCCAGCTGCTTTGGGTGGGG + Intronic
1057313199 9:93954339-93954361 CCAGGCAGCTGCTCACAGTCAGG + Intronic
1057511120 9:95680414-95680436 CCCGCCAGCTGCTCCTAGTGCGG - Intergenic
1057543880 9:96001996-96002018 CTGGCTGGCTGCTCCGAGTGCGG + Intronic
1057726901 9:97574302-97574324 TCGGCCGGCCGCTCCGAGTGCGG - Intronic
1058174888 9:101724392-101724414 CCGGCCCGCTGCTCCGAGTGCGG + Intronic
1058235701 9:102487216-102487238 CCTGCCAGCCGCTCCAAGCGCGG + Intergenic
1058286548 9:103186996-103187018 CCAGCCTGCCGTTCGGAGTGCGG - Intergenic
1058309493 9:103483796-103483818 CTGGCCAGCCGCTCCCAGTGTGG - Intergenic
1058379587 9:104363177-104363199 CCAGCTGGCTGCTCTGAGTGCGG + Intergenic
1058607678 9:106741024-106741046 CCAGCCAGCAGCTCAGAATATGG + Intergenic
1058727507 9:107817877-107817899 CCGGCCGGCCGCTCCCAGTGTGG - Intergenic
1058786475 9:108393589-108393611 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1058960637 9:109989735-109989757 CCTGCCAGCTTCTCCTACTGTGG + Intronic
1059667793 9:116465349-116465371 CCAGCCAGTTGCTCCCATTCTGG - Intronic
1059791170 9:117643004-117643026 CCGGCCGGCCGCTCCGAGTGCGG + Intergenic
1059810600 9:117852110-117852132 CCGGCGGGCCGCTCCGAGTGCGG - Intergenic
1060091336 9:120746463-120746485 CCGGCCAGCCGCTCTGAATGCGG - Intergenic
1060305390 9:122406431-122406453 CCGGCTGGCCGCTCCGAGTGTGG + Intergenic
1061873996 9:133534965-133534987 CCAGCCCACTGCTCAGAGTGGGG + Intronic
1062146228 9:134991309-134991331 CTGGCCGACTGCTCCGAGTGCGG + Intergenic
1062186369 9:135220707-135220729 CCTGTCACCTGCTGCGAGTGAGG + Intergenic
1062310579 9:135933780-135933802 CCAGACAGCTGCCGAGAGTGGGG - Intronic
1062558677 9:137129437-137129459 CCAGCCTGCGGCTCCGAGCGGGG - Intergenic
1203429789 Un_GL000195v1:80448-80470 CCAGCCGGCGGCTCCGAGTGTGG - Intergenic
1203460442 Un_GL000220v1:31263-31285 CCAGCTGGCCGCTCCAAGTGCGG + Intergenic
1203662366 Un_KI270753v1:57416-57438 CTGGCCAGTCGCTCCGAGTGCGG - Intergenic
1185891800 X:3828556-3828578 CGTGCCAGCGGCTCCGCGTGAGG - Intronic
1185896909 X:3866970-3866992 CGTGCCAGCGGCTCCGCGTGAGG - Intergenic
1185902027 X:3905396-3905418 CGTGCCAGCGGCTCCGCGTGAGG - Intergenic
1186152617 X:6690784-6690806 CCGGCCGGCCGCTCCAAGTGCGG + Intergenic
1186293174 X:8121672-8121694 CCGGCCAGCCTCTCCGAGTGCGG - Intergenic
1186323272 X:8452768-8452790 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1187005862 X:15232008-15232030 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1187304587 X:18083886-18083908 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1188078262 X:25805919-25805941 CCAGCCAGCTGCGCGGAGTGCGG + Intergenic
1189187906 X:39070097-39070119 CCGGCCTGCCGCACCGAGTGCGG + Intergenic
1190045891 X:47111281-47111303 CCAGCCGGCTGCTCCGAGTGCGG + Intergenic
1191053923 X:56222829-56222851 CTGGCCGGCGGCTCCGAGTGCGG + Intergenic
1191105067 X:56767575-56767597 CCAACTGGCTGCTCGGAGTGCGG - Intergenic
1191618656 X:63192849-63192871 CCGGCCGGCTGCTCCGAGTGTGG + Intergenic
1192869678 X:75173875-75173897 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1193538178 X:82738481-82738503 CTGGCCGGCTGCTCCGTGTGTGG + Intergenic
1193804064 X:85972635-85972657 CTGGCCGGCCGCTCCGAGTGCGG + Intronic
1194025602 X:88746604-88746626 CCAGCCGGCCGCTCTGAGTGCGG + Intergenic
1194035335 X:88863970-88863992 CCAGCCGGCGGCGCCGAGTGCGG - Intergenic
1194118050 X:89926812-89926834 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1194121225 X:89965924-89965946 CTGGCGGGCTGCTCCGAGTGCGG + Intergenic
1194166324 X:90521418-90521440 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1194384364 X:93235814-93235836 CTGGCCCGCTGCTCTGAGTGTGG - Intergenic
1194650844 X:96512529-96512551 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1195256299 X:103094197-103094219 CTGGCCGGCTGCTACGAGTGTGG - Intergenic
1195258052 X:103107627-103107649 CCAGCTGGCTGCTCTGAGTGCGG + Intergenic
1195259374 X:103117336-103117358 CCAGCCGGCTGCTCCGAGTGTGG + Intergenic
1195460276 X:105115986-105116008 CCAGCCAGCAGCTCTGAGTGCGG + Intronic
1196319552 X:114270837-114270859 CCGGCCGGCTGCTCCCAGTGCGG + Intergenic
1196582673 X:117394764-117394786 CCGGCCGGCTGCTCGGAGTGTGG - Intergenic
1196714592 X:118799039-118799061 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1196728954 X:118922261-118922283 CTGGCTGGCTGCTCCGAGTGTGG + Intergenic
1196741502 X:119029597-119029619 CTGGCCAGCTGCTCTGAGTGCGG - Intergenic
1196761995 X:119208750-119208772 CCGGCCAGCTGCTCCGAGCGCGG + Intergenic
1196775486 X:119333678-119333700 CCAGCCGTCTGCTCCGAGTGCGG - Intergenic
1196781483 X:119387862-119387884 CTGGCCGGCTGCTCCCAGTGCGG + Intergenic
1196794001 X:119488141-119488163 CTGGCCGGCTGCTCCGAGTGCGG + Intergenic
1196802392 X:119555430-119555452 GCAGAAAGCTGCTCTGAGTGGGG - Intronic
1196827298 X:119751106-119751128 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1196845038 X:119890674-119890696 CCGGCCGGCTGCTCCGAGTGCGG - Intergenic
1197331196 X:125155738-125155760 CCGGCCGGCCACTCCGAGTGTGG + Intergenic
1197340031 X:125255730-125255752 CCGGCCGGCTGCTCCGAGTGTGG - Intergenic
1197376821 X:125690857-125690879 CCAGCCGGCCGCTCAGAGTGCGG + Intergenic
1197607908 X:128606688-128606710 CCCGCCGGCCGCTCCGAGTGCGG - Intergenic
1197712813 X:129684079-129684101 CCAGCCCGAGGCTCGGAGTGGGG + Intergenic
1197978740 X:132194169-132194191 CTGGCCAGCCACTCCGAGTGTGG - Intergenic
1198299963 X:135325537-135325559 CCGGCCGGCTGCTCCGAGTGCGG - Intronic
1198664331 X:139004303-139004325 CCGGCCGGCTGTTCTGAGTGCGG + Intronic
1198972612 X:142298523-142298545 CCAGCCGGCTGCTCCGAGTGCGG + Intergenic
1199009962 X:142746001-142746023 CTGGCCGGCTGCTCTGAGTGCGG + Intergenic
1199028818 X:142972414-142972436 CTGGCCAGCTGCTCCGAGTGTGG + Intergenic
1199050248 X:143228968-143228990 CCAGCCGGCTGCTCTGAGAGAGG + Intergenic
1199356270 X:146867160-146867182 CCAGCCGGCTGCTCCGAGTGTGG + Intergenic
1199443696 X:147897252-147897274 CCAGCCAGCTGCACCCAGTGTGG + Intergenic
1199529442 X:148830342-148830364 ACAGGCTGCTGCTCCCAGTGTGG - Intronic
1199628095 X:149758651-149758673 CCAGCCGGCCGCTCTGAGTGCGG - Intergenic
1199831305 X:151551465-151551487 CTGGCCGGCTGCTCTGAGTGCGG + Intergenic
1200423585 Y:2998653-2998675 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1200470927 Y:3584375-3584397 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1200474081 Y:3623375-3623397 CTGGCGGGCTGCTCCGAGTGCGG + Intergenic
1200512592 Y:4099199-4099221 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1200725857 Y:6667036-6667058 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1200748406 Y:6922850-6922872 CCGGCCAGCTGCGCCAAGTGCGG + Intronic
1200824317 Y:7622494-7622516 CTGGCCGGCTGCTCCGAGTGTGG + Intergenic
1200888661 Y:8298700-8298722 CTGGCCGCCTGCTCCGAGTGCGG - Intergenic
1201285504 Y:12375286-12375308 CCGGCCGGCTGCTCCGAGTGCGG + Intergenic
1201423064 Y:13820482-13820504 CCGGCTGGCTGCTCCGGGTGTGG + Intergenic
1201424229 Y:13831433-13831455 GCAGCCGGCTGCTCCGAGTTCGG - Intergenic
1201495708 Y:14590061-14590083 CTGGCCGGCTGCTCCGAGTGCGG + Intronic
1201496954 Y:14598474-14598496 CTGGCCGGCTGCTCCGAGTGCGG + Intronic
1201715784 Y:17043189-17043211 CTGGCCGACTGCTCCGAGTGCGG - Intergenic
1201729946 Y:17192538-17192560 CCGGCCAGCCCTTCCGAGTGTGG + Intergenic
1201982641 Y:19923994-19924016 CTGGCCGGCTGCTCCGAGTGTGG + Intergenic
1202090493 Y:21183504-21183526 CCAGCCGGCCGCACCGAGTGTGG - Intergenic
1202137117 Y:21676940-21676962 CGGGCCGGCTGCTCTGAGTGTGG + Intergenic
1202235738 Y:22708593-22708615 CTGGCCGGCTGCTCCGAGTGTGG - Intergenic
1202272678 Y:23086041-23086063 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1202293348 Y:23334641-23334663 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1202307425 Y:23487575-23487597 CTGGCCGGCTGCTCCGAGTGTGG + Intergenic
1202425675 Y:24719785-24719807 CTGGCTGGCTGCTCCGAGTGCGG + Intergenic
1202445114 Y:24950300-24950322 CTGGCTGGCTGCTCCGAGTGCGG - Intergenic
1202563380 Y:26183011-26183033 CTGGCCGGCTGCTCCGAGTGTGG - Intergenic