ID: 1082698777

View in Genome Browser
Species Human (GRCh38)
Location 11:56402198-56402220
Sequence CAGCCAGCTGCTCCGAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082698766_1082698777 3 Left 1082698766 11:56402172-56402194 CCCTTATTGCCCAGGGCCAGCAG No data
Right 1082698777 11:56402198-56402220 CAGCCAGCTGCTCCGAGTGGGGG No data
1082698767_1082698777 2 Left 1082698767 11:56402173-56402195 CCTTATTGCCCAGGGCCAGCAGG No data
Right 1082698777 11:56402198-56402220 CAGCCAGCTGCTCCGAGTGGGGG No data
1082698761_1082698777 24 Left 1082698761 11:56402151-56402173 CCGCTGGCCTGGGTGCTAAGCCC 0: 54
1: 275
2: 367
3: 198
4: 260
Right 1082698777 11:56402198-56402220 CAGCCAGCTGCTCCGAGTGGGGG No data
1082698762_1082698777 17 Left 1082698762 11:56402158-56402180 CCTGGGTGCTAAGCCCCTTATTG No data
Right 1082698777 11:56402198-56402220 CAGCCAGCTGCTCCGAGTGGGGG No data
1082698770_1082698777 -6 Left 1082698770 11:56402181-56402203 CCCAGGGCCAGCAGGGCCAGCCA No data
Right 1082698777 11:56402198-56402220 CAGCCAGCTGCTCCGAGTGGGGG No data
1082698771_1082698777 -7 Left 1082698771 11:56402182-56402204 CCAGGGCCAGCAGGGCCAGCCAG No data
Right 1082698777 11:56402198-56402220 CAGCCAGCTGCTCCGAGTGGGGG No data
1082698760_1082698777 30 Left 1082698760 11:56402145-56402167 CCGCAGCCGCTGGCCTGGGTGCT No data
Right 1082698777 11:56402198-56402220 CAGCCAGCTGCTCCGAGTGGGGG No data
1082698765_1082698777 4 Left 1082698765 11:56402171-56402193 CCCCTTATTGCCCAGGGCCAGCA No data
Right 1082698777 11:56402198-56402220 CAGCCAGCTGCTCCGAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082698777 Original CRISPR CAGCCAGCTGCTCCGAGTGG GGG Intergenic
No off target data available for this crispr