ID: 1082703845 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:56468049-56468071 |
| Sequence | GAAAATGCACATATACATCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1082703841_1082703845 | 9 | Left | 1082703841 | 11:56468017-56468039 | CCTAAAAGCCCATTGGTGATAAA | No data | ||
| Right | 1082703845 | 11:56468049-56468071 | GAAAATGCACATATACATCATGG | No data | ||||
| 1082703843_1082703845 | 1 | Left | 1082703843 | 11:56468025-56468047 | CCCATTGGTGATAAACTGGATAA | No data | ||
| Right | 1082703845 | 11:56468049-56468071 | GAAAATGCACATATACATCATGG | No data | ||||
| 1082703844_1082703845 | 0 | Left | 1082703844 | 11:56468026-56468048 | CCATTGGTGATAAACTGGATAAA | No data | ||
| Right | 1082703845 | 11:56468049-56468071 | GAAAATGCACATATACATCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1082703845 | Original CRISPR | GAAAATGCACATATACATCA TGG | Intergenic | ||
| No off target data available for this crispr | |||||