ID: 1082703845

View in Genome Browser
Species Human (GRCh38)
Location 11:56468049-56468071
Sequence GAAAATGCACATATACATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082703841_1082703845 9 Left 1082703841 11:56468017-56468039 CCTAAAAGCCCATTGGTGATAAA No data
Right 1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG No data
1082703843_1082703845 1 Left 1082703843 11:56468025-56468047 CCCATTGGTGATAAACTGGATAA No data
Right 1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG No data
1082703844_1082703845 0 Left 1082703844 11:56468026-56468048 CCATTGGTGATAAACTGGATAAA No data
Right 1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082703845 Original CRISPR GAAAATGCACATATACATCA TGG Intergenic
No off target data available for this crispr