ID: 1082704342

View in Genome Browser
Species Human (GRCh38)
Location 11:56475343-56475365
Sequence GGAAATATTATGCACCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082704342_1082704346 -1 Left 1082704342 11:56475343-56475365 CCAGTAAGGTGCATAATATTTCC No data
Right 1082704346 11:56475365-56475387 CCATCCTACTTGCTTACCTTGGG No data
1082704342_1082704344 -2 Left 1082704342 11:56475343-56475365 CCAGTAAGGTGCATAATATTTCC No data
Right 1082704344 11:56475364-56475386 CCCATCCTACTTGCTTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082704342 Original CRISPR GGAAATATTATGCACCTTAC TGG (reversed) Intergenic
No off target data available for this crispr