ID: 1082704346

View in Genome Browser
Species Human (GRCh38)
Location 11:56475365-56475387
Sequence CCATCCTACTTGCTTACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082704342_1082704346 -1 Left 1082704342 11:56475343-56475365 CCAGTAAGGTGCATAATATTTCC No data
Right 1082704346 11:56475365-56475387 CCATCCTACTTGCTTACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082704346 Original CRISPR CCATCCTACTTGCTTACCTT GGG Intergenic
No off target data available for this crispr