ID: 1082706044

View in Genome Browser
Species Human (GRCh38)
Location 11:56496547-56496569
Sequence AGGAAGAGGGAGACCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082706044_1082706050 1 Left 1082706044 11:56496547-56496569 CCCTCCACGGTCTCCCTCTTCCT No data
Right 1082706050 11:56496571-56496593 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593
1082706044_1082706059 29 Left 1082706044 11:56496547-56496569 CCCTCCACGGTCTCCCTCTTCCT No data
Right 1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG 0: 32
1: 146
2: 615
3: 538
4: 543
1082706044_1082706056 25 Left 1082706044 11:56496547-56496569 CCCTCCACGGTCTCCCTCTTCCT No data
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082706044 Original CRISPR AGGAAGAGGGAGACCGTGGA GGG (reversed) Intergenic
No off target data available for this crispr