ID: 1082706050

View in Genome Browser
Species Human (GRCh38)
Location 11:56496571-56496593
Sequence TCCCTCTCCCTCTCTCTCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2880
Summary {0: 71, 1: 733, 2: 184, 3: 299, 4: 1593}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082706044_1082706050 1 Left 1082706044 11:56496547-56496569 CCCTCCACGGTCTCCCTCTTCCT No data
Right 1082706050 11:56496571-56496593 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593
1082706045_1082706050 0 Left 1082706045 11:56496548-56496570 CCTCCACGGTCTCCCTCTTCCTC No data
Right 1082706050 11:56496571-56496593 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593
1082706038_1082706050 22 Left 1082706038 11:56496526-56496548 CCACGGTCTCCCTCTCCCTCTCC 0: 155
1: 628
2: 447
3: 637
4: 3112
Right 1082706050 11:56496571-56496593 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593
1082706040_1082706050 13 Left 1082706040 11:56496535-56496557 CCCTCTCCCTCTCCCTCCACGGT 0: 38
1: 92
2: 651
3: 642
4: 1285
Right 1082706050 11:56496571-56496593 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593
1082706046_1082706050 -3 Left 1082706046 11:56496551-56496573 CCACGGTCTCCCTCTTCCTCTCC 0: 2
1: 160
2: 641
3: 567
4: 1825
Right 1082706050 11:56496571-56496593 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593
1082706037_1082706050 26 Left 1082706037 11:56496522-56496544 CCTTCCACGGTCTCCCTCTCCCT 0: 11
1: 5
2: 11
3: 298
4: 903
Right 1082706050 11:56496571-56496593 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593
1082706043_1082706050 6 Left 1082706043 11:56496542-56496564 CCTCTCCCTCCACGGTCTCCCTC 0: 43
1: 97
2: 781
3: 682
4: 920
Right 1082706050 11:56496571-56496593 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593
1082706042_1082706050 7 Left 1082706042 11:56496541-56496563 CCCTCTCCCTCCACGGTCTCCCT 0: 44
1: 95
2: 678
3: 688
4: 908
Right 1082706050 11:56496571-56496593 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593
1082706041_1082706050 12 Left 1082706041 11:56496536-56496558 CCTCTCCCTCTCCCTCCACGGTC 0: 41
1: 87
2: 646
3: 465
4: 1325
Right 1082706050 11:56496571-56496593 TCCCTCTCCCTCTCTCTCCACGG 0: 71
1: 733
2: 184
3: 299
4: 1593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082706050 Original CRISPR TCCCTCTCCCTCTCTCTCCA CGG Intergenic
Too many off-targets to display for this crispr