ID: 1082706056

View in Genome Browser
Species Human (GRCh38)
Location 11:56496595-56496617
Sequence ATCCCTCTGATGCCCAGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082706053_1082706056 -6 Left 1082706053 11:56496578-56496600 CCCTCTCTCTCCACGGTATCCCT No data
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data
1082706051_1082706056 0 Left 1082706051 11:56496572-56496594 CCCTCTCCCTCTCTCTCCACGGT 0: 74
1: 664
2: 298
3: 201
4: 1258
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data
1082706054_1082706056 -7 Left 1082706054 11:56496579-56496601 CCTCTCTCTCCACGGTATCCCTC No data
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data
1082706043_1082706056 30 Left 1082706043 11:56496542-56496564 CCTCTCCCTCCACGGTCTCCCTC 0: 43
1: 97
2: 781
3: 682
4: 920
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data
1082706052_1082706056 -1 Left 1082706052 11:56496573-56496595 CCTCTCCCTCTCTCTCCACGGTA No data
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data
1082706045_1082706056 24 Left 1082706045 11:56496548-56496570 CCTCCACGGTCTCCCTCTTCCTC No data
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data
1082706047_1082706056 12 Left 1082706047 11:56496560-56496582 CCCTCTTCCTCTCCCTCTCCCTC No data
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data
1082706046_1082706056 21 Left 1082706046 11:56496551-56496573 CCACGGTCTCCCTCTTCCTCTCC 0: 2
1: 160
2: 641
3: 567
4: 1825
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data
1082706049_1082706056 5 Left 1082706049 11:56496567-56496589 CCTCTCCCTCTCCCTCTCTCTCC 0: 66
1: 386
2: 3028
3: 6953
4: 18047
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data
1082706048_1082706056 11 Left 1082706048 11:56496561-56496583 CCTCTTCCTCTCCCTCTCCCTCT 0: 20
1: 2006
2: 1836
3: 4052
4: 15092
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data
1082706044_1082706056 25 Left 1082706044 11:56496547-56496569 CCCTCCACGGTCTCCCTCTTCCT No data
Right 1082706056 11:56496595-56496617 ATCCCTCTGATGCCCAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082706056 Original CRISPR ATCCCTCTGATGCCCAGCCG AGG Intergenic
No off target data available for this crispr