ID: 1082706059

View in Genome Browser
Species Human (GRCh38)
Location 11:56496599-56496621
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1874
Summary {0: 32, 1: 146, 2: 615, 3: 538, 4: 543}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082706053_1082706059 -2 Left 1082706053 11:56496578-56496600 CCCTCTCTCTCCACGGTATCCCT No data
Right 1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG 0: 32
1: 146
2: 615
3: 538
4: 543
1082706048_1082706059 15 Left 1082706048 11:56496561-56496583 CCTCTTCCTCTCCCTCTCCCTCT 0: 20
1: 2006
2: 1836
3: 4052
4: 15092
Right 1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG 0: 32
1: 146
2: 615
3: 538
4: 543
1082706054_1082706059 -3 Left 1082706054 11:56496579-56496601 CCTCTCTCTCCACGGTATCCCTC No data
Right 1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG 0: 32
1: 146
2: 615
3: 538
4: 543
1082706049_1082706059 9 Left 1082706049 11:56496567-56496589 CCTCTCCCTCTCCCTCTCTCTCC 0: 66
1: 386
2: 3028
3: 6953
4: 18047
Right 1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG 0: 32
1: 146
2: 615
3: 538
4: 543
1082706047_1082706059 16 Left 1082706047 11:56496560-56496582 CCCTCTTCCTCTCCCTCTCCCTC No data
Right 1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG 0: 32
1: 146
2: 615
3: 538
4: 543
1082706045_1082706059 28 Left 1082706045 11:56496548-56496570 CCTCCACGGTCTCCCTCTTCCTC No data
Right 1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG 0: 32
1: 146
2: 615
3: 538
4: 543
1082706046_1082706059 25 Left 1082706046 11:56496551-56496573 CCACGGTCTCCCTCTTCCTCTCC 0: 2
1: 160
2: 641
3: 567
4: 1825
Right 1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG 0: 32
1: 146
2: 615
3: 538
4: 543
1082706052_1082706059 3 Left 1082706052 11:56496573-56496595 CCTCTCCCTCTCTCTCCACGGTA No data
Right 1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG 0: 32
1: 146
2: 615
3: 538
4: 543
1082706044_1082706059 29 Left 1082706044 11:56496547-56496569 CCCTCCACGGTCTCCCTCTTCCT No data
Right 1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG 0: 32
1: 146
2: 615
3: 538
4: 543
1082706051_1082706059 4 Left 1082706051 11:56496572-56496594 CCCTCTCCCTCTCTCTCCACGGT 0: 74
1: 664
2: 298
3: 201
4: 1258
Right 1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG 0: 32
1: 146
2: 615
3: 538
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082706059 Original CRISPR CTCTGATGCCCAGCCGAGGC TGG Intergenic
900270322 1:1783672-1783694 CTCTGGTGCCCAGGGGAGGAGGG + Intergenic
900919912 1:5663469-5663491 CTCTGCTGCCCTGCCCTGGCCGG + Intergenic
901030882 1:6306146-6306168 CTCTGATGCCGAGCCGAAGCTGG - Intronic
901100679 1:6716231-6716253 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
901270819 1:7952115-7952137 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
901555451 1:10028400-10028422 CTCTGATGCCAAGCTGAAGCTGG + Intergenic
901686543 1:10946649-10946671 CTTAGATGCCCAGCTGTGGCTGG - Exonic
901734975 1:11306528-11306550 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
901735191 1:11307910-11307932 CTCTGTCACCCAGCCCAGGCTGG - Intergenic
901850031 1:12009157-12009179 CTCTGATGCCGAGCCGAAGCTGG - Intronic
901855646 1:12042712-12042734 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
901907458 1:12426255-12426277 CTCTGCTTCCCAGGCCAGGCGGG - Intronic
901970228 1:12902432-12902454 CTCTGATGCCGAGCCGAAGCTGG + Intronic
902014939 1:13299337-13299359 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
902018496 1:13327676-13327698 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
902027662 1:13395643-13395665 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
902917648 1:19648352-19648374 CTCTGAGGCCCAGCCAGGCCAGG - Intronic
903081195 1:20814821-20814843 CTCTGATGCCGAGCCAAAGCTGG + Intronic
903103247 1:21052619-21052641 CCCTGATGCCGAGCCAAAGCTGG + Intronic
903147881 1:21387087-21387109 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
903163131 1:21503414-21503436 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
903426298 1:23256851-23256873 CTCTCATGCCAAGCCGAAGCTGG + Intergenic
903458166 1:23503307-23503329 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
903485679 1:23688226-23688248 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
903507999 1:23852514-23852536 CACTGATGCCGAGCCGAAGCTGG + Intronic
903519271 1:23935029-23935051 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
903531367 1:24032835-24032857 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
903633760 1:24798694-24798716 CTCTCATGCGGAGCCGAAGCTGG + Intronic
903638140 1:24834778-24834800 CTCTCATGCCGAGCCAAAGCTGG - Intronic
903748296 1:25603298-25603320 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
903894594 1:26595515-26595537 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
903961949 1:27063484-27063506 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
903993498 1:27289942-27289964 CTCTGATGCCGAGCCGAAGCTGG - Intronic
904006995 1:27368284-27368306 CTCTGTCGCCCCGCCCAGGCTGG - Intergenic
904007023 1:27368464-27368486 CTCTGTCGCCCTGCCCAGGCTGG - Intergenic
904040872 1:27584252-27584274 CTCTGATGCCAACCCCAGGGAGG + Intronic
904531919 1:31175848-31175870 CTCTCATGCCCAGCTGAAGCTGG + Intergenic
904761155 1:32805185-32805207 CTCTGATGCCGAGCCGAGGCTGG - Intronic
904784938 1:32975797-32975819 CTCTGATGCGGAGCCAAAGCTGG - Intergenic
904831807 1:33310260-33310282 CTCTGATGCCGAGCCGAGGCTGG - Intronic
904857486 1:33510104-33510126 CTCTGATGCCCAGCCGAAGCTGG - Intergenic
905315441 1:37079817-37079839 CTCTCATGCCGAGCAGAAGCTGG + Intergenic
905427194 1:37895551-37895573 CTCTGATGCCGAGCCGAAGCTGG + Intronic
905478403 1:38244939-38244961 CTCTCATGCCCACCCCAGGTTGG + Intergenic
905511312 1:38522613-38522635 CTATGTTGCCCAGCCCAGCCTGG + Intergenic
905526913 1:38646847-38646869 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
905686781 1:39913973-39913995 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
905699168 1:39999092-39999114 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
905901704 1:41585733-41585755 CTCCGAGGCACAGTCGAGGCAGG - Intronic
906136003 1:43501322-43501344 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
906329809 1:44875823-44875845 CTCTGATGCCGAGCCAAAGCTGG + Intronic
906353233 1:45081349-45081371 CTCTCACGCCAAGCCGAAGCTGG + Intronic
906357139 1:45116064-45116086 CTCTGATGCCCAGCCGAGGCTGG - Intronic
906370212 1:45247508-45247530 CTTTGATGCCTAGCCGAGGCTGG + Intronic
906427038 1:45724020-45724042 CTCTGATGCCGAGCCAAAGCTGG + Intronic
906511666 1:46413610-46413632 CTCTGCAGCCCAGCCTAGTCAGG + Exonic
906741799 1:48191790-48191812 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
906762075 1:48384293-48384315 CTCTGATGCCGAGCCAAGGCTGG - Intronic
906770461 1:48478776-48478798 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
906956667 1:50381051-50381073 CCCTGATGCCGAGCCAAAGCTGG + Intergenic
907009689 1:50952146-50952168 CTCTGATGCCCAGCCGAGGCTGG + Intronic
907140411 1:52181121-52181143 CTCTGATGCCGAGCCGAAGCTGG + Intronic
907216801 1:52870818-52870840 CTCTGATGCCGAGCCAAAGCTGG - Intronic
907402292 1:54232631-54232653 CTCTCATGCGGAGCCGAAGCTGG + Intronic
907822804 1:57987729-57987751 CTCTGAGCGCCAGCAGAGGCAGG - Intronic
908370042 1:63472509-63472531 CTCTGATGCCGAGCCAAAGGTGG + Intronic
908445990 1:64200503-64200525 CTCTGATGCCAAGCCAAAGCTGG + Intergenic
908467698 1:64414287-64414309 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
909479176 1:76113296-76113318 CTCTGATGCCGAGCGGAAGCTGG - Intronic
909641298 1:77871043-77871065 CTCTGATGCCGAGCCAAAGCTGG - Intronic
910343618 1:86215151-86215173 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
910407117 1:86900545-86900567 CTCTGATGCCGAGCCGAAGCTGG - Intronic
910412863 1:86964595-86964617 CTCTGATGCCGAGCCGAAGCTGG - Intronic
910777684 1:90892496-90892518 CTCTGATGCCTAGCCGAAGCTGG - Intergenic
910815868 1:91289817-91289839 CTCTGATGCTGAGCTGAGGCTGG - Intronic
910891818 1:92026842-92026864 CTCTGATGCCCAGCGGAGGCTGG - Intergenic
911326012 1:96470550-96470572 CACTGATGCCGAGCCGAAGCTGG - Intergenic
911351945 1:96763535-96763557 CTCTGATGACGAGCCGAAGCTGG - Intronic
911486848 1:98513569-98513591 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
911534151 1:99079411-99079433 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
911598430 1:99822994-99823016 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
911602195 1:99857769-99857791 CTCTGATGCCGAGCCAAGGCTGG - Intronic
912116162 1:106411874-106411896 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
912133714 1:106633623-106633645 CTGTGTTGCCCAGGCTAGGCTGG + Intergenic
912246783 1:107968276-107968298 CTCTGATGACCAGCCAGGGCAGG - Intergenic
912266327 1:108160907-108160929 CTCTGATGCCGAGCCAAAGCTGG - Intronic
912303094 1:108536775-108536797 CTCTGATGCAGAGCTGAAGCTGG - Intergenic
912306121 1:108569350-108569372 CTCTGTTGCCCAGGCTAGACAGG + Intronic
912316821 1:108675119-108675141 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
912355610 1:109052689-109052711 CTCTGATGCCGAGCAGAGGCTGG + Intergenic
912751533 1:112292620-112292642 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
912844186 1:113064334-113064356 CTCTGATGCCAAGCCGAAGCTGG - Intergenic
913021302 1:114791422-114791444 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
913022957 1:114805288-114805310 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
913160266 1:116138934-116138956 CTCTGTAGCCCAGCCCAGGCTGG - Intergenic
913306379 1:117431156-117431178 CTCTCATGCGGAGCCGAAGCTGG - Intronic
913993601 1:143637114-143637136 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
914001967 1:143702102-143702124 CCCTGATGCCGAGCCAAAGCTGG + Intergenic
914230824 1:145763952-145763974 CTCTGATGCCGAGCCGAAGCTGG + Intronic
914231688 1:145767930-145767952 CTCTGATGCCGAGCCGAAGCTGG - Intronic
914374455 1:147061325-147061347 CTCTGATGCTGAGCTGAGGCTGG + Intergenic
914392026 1:147232537-147232559 CTGTGATGCCGAGCCGAAGCTGG + Intronic
914468482 1:147950890-147950912 CACTGATGCTGAGCCGAAGCTGG - Intronic
914688560 1:150004528-150004550 CTCTGTTGTCCAGCTCAGGCTGG - Intronic
914775437 1:150729932-150729954 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
914780428 1:150780914-150780936 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
914787796 1:150850320-150850342 CTCTGATGCCGAGCCGAAGCTGG + Intronic
914887844 1:151599627-151599649 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
914893996 1:151652148-151652170 CTCTCATGCGGAGCCGAAGCTGG - Intronic
914954102 1:152145595-152145617 CTCTGATGCCCAGCCGAAGCTGG - Intergenic
914960048 1:152197181-152197203 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
914965965 1:152257106-152257128 CTCTGATGCTGAGCGGAAGCTGG - Intergenic
914987470 1:152472713-152472735 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
915111419 1:153566580-153566602 CCCTGATGCCCAGACGGGCCGGG - Intronic
915112637 1:153574512-153574534 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
915113723 1:153582353-153582375 CTCTGATGCCAAGCCGAAGCTGG + Intergenic
915208232 1:154286958-154286980 CTCTGATGTCGAGCCAAAGCTGG + Intergenic
915295279 1:154916882-154916904 CTATGTTGCCCAGGCTAGGCTGG + Intergenic
915502191 1:156327329-156327351 CTCTGATGCCGAGCTGAAGCTGG + Intronic
915835253 1:159171399-159171421 CTCTGATCCACACCCGAGCCCGG + Intergenic
915861422 1:159449227-159449249 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
916049898 1:161029006-161029028 CTCTGATGCCGAGCCGAGGCTGG + Intronic
916087643 1:161282344-161282366 CTCTGATGCCCAGCTGAAGCTGG - Intronic
916104643 1:161422316-161422338 CTCTGATGCGGAGCTGAAGCTGG + Intergenic
916223271 1:162465441-162465463 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
916324993 1:163546472-163546494 CCCTCATGCCGAGCCGAGGCTGG - Intergenic
916595347 1:166237173-166237195 AACTGATGCCCAGCCAAGGAGGG - Intergenic
916657362 1:166887918-166887940 CTCTGTCGCCCAGGCCAGGCTGG - Intergenic
916800171 1:168208568-168208590 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
916863993 1:168836792-168836814 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
917006023 1:170418290-170418312 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
917126805 1:171694606-171694628 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
917304453 1:173612629-173612651 CTCTGATGCTGAGCTGAAGCTGG + Intronic
917376256 1:174351037-174351059 CTCTCATGCGGAGCCGAAGCTGG - Intronic
917583294 1:176397533-176397555 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
917848588 1:179041583-179041605 CTCTGATGCCGAGCCGAAGCTGG - Intronic
917859736 1:179134768-179134790 CTCTGATGCCGAGCTGAAGCTGG + Intronic
917889296 1:179419571-179419593 CTCTGATGCCGAGCTGAAGCTGG - Intronic
918022881 1:180711571-180711593 CTCTGACGCCGAGCCCAAGCTGG - Intronic
918172322 1:182010265-182010287 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
918220290 1:182430523-182430545 CTCTGATGCACAGGAGAGGAAGG - Intergenic
918221564 1:182440594-182440616 CTCTGATGCCAAGCCGAAGCTGG - Intergenic
918255507 1:182742696-182742718 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
918812648 1:189140569-189140591 CTCTGATGCCCAGCTGAGGCTGG - Intergenic
918818662 1:189225091-189225113 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
919079833 1:192856412-192856434 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
919271046 1:195345492-195345514 CTCTAATTCCAAGCCGAGGCGGG - Intergenic
919423739 1:197405114-197405136 CTCTGATGCCGAGCCGAAGCTGG + Intronic
919625410 1:199905297-199905319 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
919926054 1:202192443-202192465 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
919959567 1:202452507-202452529 CTCTGATGCCAAGCCGAAGCTGG - Intronic
920354872 1:205364567-205364589 CTCTGTTGCCAAGGCCAGGCTGG + Intergenic
920528980 1:206687901-206687923 TTCTGAACCCCAGCAGAGGCTGG - Intronic
920789841 1:209079524-209079546 CTCTGGTGCCCAGTCAAGTCAGG + Intergenic
920794781 1:209128516-209128538 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
921108999 1:212014584-212014606 CTCTGATGCCGAGCGGAGGCTGG + Intronic
921192627 1:212724284-212724306 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
921197940 1:212778437-212778459 CTCTGATGCCGAGCCGAAGCTGG + Intronic
921638587 1:217524818-217524840 CTCTGATGCCAAGCCGAAGCTGG - Intronic
921720843 1:218469361-218469383 TTCTGTTGCCCAGCCCAGGCTGG - Intergenic
921813894 1:219545043-219545065 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
921902940 1:220467475-220467497 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
922102274 1:222486922-222486944 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
922102302 1:222487037-222487059 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
922278368 1:224100255-224100277 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
922306674 1:224350620-224350642 CTCTGATGTCCAGCCGAGGCTGG - Intergenic
922436806 1:225615081-225615103 CTCTGATGCCGAGCGGAGGCTGG + Intronic
922490548 1:226013236-226013258 CTACCATGCCCAGCCAAGGCTGG - Intergenic
922504002 1:226115906-226115928 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
922632651 1:227132178-227132200 CTCTGATGCCGAGCCAAAGCTGG + Intronic
922644733 1:227275641-227275663 CTCTGATGCCAAGCGGAGGCTGG + Intronic
922693346 1:227711808-227711830 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
922933382 1:229407248-229407270 CTCTGCTGCATAGGCGAGGCAGG + Intergenic
922993148 1:229932522-229932544 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
923136943 1:231127938-231127960 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
923174736 1:231453593-231453615 CTCTAATGCGGAGCCGAGGCTGG + Intergenic
923468403 1:234268410-234268432 CTCTGATGCCGAGCCAAAGCTGG - Intronic
923589724 1:235308513-235308535 CTCTGATGCCGAGCCGAAGCTGG + Intronic
923694621 1:236235784-236235806 CTCTGGCGCCTAGCCGAGGTAGG - Exonic
923716514 1:236429093-236429115 CTCTGATGCCCAGCCGAGGCTGG - Intronic
923716526 1:236429151-236429173 CTCTGATGCCGAGCCGAGGCTGG - Intronic
923793184 1:237128331-237128353 CTCTCATGCTGAGCCGAAGCTGG - Intronic
923841011 1:237670246-237670268 CTCTGATGCCGAGCCGAAGCTGG - Intronic
923895959 1:238270327-238270349 CTCTCTTGCCCAGCCCAGGCTGG + Intergenic
924351540 1:243119290-243119312 CTGTATTGCCCAGCCCAGGCTGG + Intergenic
924634673 1:245774739-245774761 CTCTGATGCTGAGCCGAAGCTGG + Intronic
924692113 1:246362499-246362521 CTCTGATGCCGAGCCGAAGCTGG + Intronic
924765826 1:247031603-247031625 CTCTGATGCTGAGCCGAAGCTGG + Intergenic
924788252 1:247220027-247220049 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
924823990 1:247521419-247521441 CTCTGATGCCGAGCGGAAGCTGG + Intronic
924925490 1:248676339-248676361 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
924943598 1:248829809-248829831 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1063084827 10:2806937-2806959 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1063459737 10:6207394-6207416 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1063744781 10:8868418-8868440 CTCTCATGCCGAGCTGAAGCTGG + Intergenic
1063776907 10:9273944-9273966 TTCTGTTGCCGAGCCAAGGCTGG - Intergenic
1064070891 10:12227213-12227235 CTCTGATGCCGAGCAGAGGCTGG - Intronic
1064096226 10:12426576-12426598 CTCTGTCACCCAGCCCAGGCTGG + Intronic
1064108819 10:12520886-12520908 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1064109255 10:12523702-12523724 CTCTGATGCCCAGCCAAAGCTGG - Intronic
1065357442 10:24856237-24856259 CTCTGTCGCCCAGCCCAAGCTGG - Intronic
1065357490 10:24856556-24856578 CTCTGTTGCCCAGGCTGGGCTGG - Intronic
1065737905 10:28771208-28771230 CTCTGATGCTGAGCAGAGGCTGG + Intergenic
1065951974 10:30660335-30660357 CTCTGTTGCCTTGCCCAGGCTGG - Intergenic
1066085162 10:31969122-31969144 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1066140669 10:32501003-32501025 CTCTGATGCCGAGCGGAGGCTGG - Intronic
1066325214 10:34352384-34352406 CTCTGATGCCGAGCCGAGGCTGG + Intronic
1066330711 10:34418969-34418991 CTATGCTGCCCAGCCCAGGCAGG + Intronic
1066390763 10:34975994-34976016 CTCTGATGCTGAGCCGAAGCTGG + Intergenic
1066952757 10:42137581-42137603 CTCTGATGCTGAGCCAAAGCTGG + Intergenic
1067026307 10:42846740-42846762 CTCTGATGCTGAGCAGAAGCTGG + Intergenic
1067029597 10:42871353-42871375 CTCTGATGCCCACCCACGCCCGG + Intergenic
1067114261 10:43422673-43422695 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
1067120228 10:43466145-43466167 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1067325029 10:45259355-45259377 CTCTCATGCCGAGCGGAAGCTGG + Intergenic
1067331999 10:45330866-45330888 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1067339622 10:45391131-45391153 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1067354310 10:45511446-45511468 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1067391396 10:45866322-45866344 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1067871894 10:49969829-49969851 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1067911946 10:50355313-50355335 CTCTGATGCCAAGCCGAGGCTGG + Intronic
1068667832 10:59696142-59696164 CTCTGATGCCCAGCCGAAGCTGG + Intronic
1068673096 10:59743703-59743725 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
1068969439 10:62947063-62947085 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1069052859 10:63812421-63812443 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1069157696 10:65051770-65051792 CTCTGATGCCAAGCCGAAGCTGG + Intergenic
1069365491 10:67690930-67690952 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1069645612 10:69993826-69993848 CTCTGATGCCGAGCCAAGGCTGG - Intergenic
1069741614 10:70688814-70688836 CTCTCATGCGGAGCCGAAGCTGG - Intronic
1069929125 10:71870402-71870424 CTCTGATGCAGAGCTGAAGCTGG - Intergenic
1069930206 10:71876653-71876675 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1070135299 10:73689025-73689047 CTCTGATGCCCAGCCGAAGCTGG + Intronic
1070310867 10:75272950-75272972 CTCTGATGCCCAGTCCAGCCTGG - Intergenic
1070367595 10:75751272-75751294 CTCTGATGCCGAGCCGAGGCTGG - Intronic
1070629821 10:78076614-78076636 CTCTGATGCCCAGCGGAAGCTGG - Intergenic
1070684310 10:78469641-78469663 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1070807669 10:79279919-79279941 CTCTGATACCTAGCCGAGGCTGG - Intronic
1070816788 10:79329346-79329368 CTCTGATGCCCAGGAGAGGTAGG + Intergenic
1070966311 10:80533427-80533449 CCCTGATGCCGAGCCAAAGCTGG + Intergenic
1071289879 10:84181043-84181065 CTCTGATGCTGAGCCAAGGCTGG - Intronic
1071311634 10:84348409-84348431 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1071538189 10:86454416-86454438 CTCTGATGCCAAGCCGAGGCTGG + Intronic
1071616308 10:87079976-87079998 CTCTGATGCCGAGCGGAAGCTGG + Intronic
1072013615 10:91324226-91324248 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
1072291555 10:93970078-93970100 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1072602561 10:96942400-96942422 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1072684776 10:97529702-97529724 CTCTCATGCCGAGCCGAAGCTGG - Intronic
1072730187 10:97841048-97841070 CTCTCACGCCGAGCCGAAGCTGG + Intergenic
1072772239 10:98151991-98152013 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1072980004 10:100092229-100092251 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1073221526 10:101878437-101878459 CTATGTTGCCCAGGCTAGGCTGG - Intronic
1073238076 10:102035442-102035464 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1073275011 10:102302222-102302244 CTCTGATGCCAAGCCGAAGCTGG - Intronic
1073385885 10:103128114-103128136 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1073450519 10:103606533-103606555 CTCGGATGCCGAGCCGAAGCTGG + Intronic
1074144219 10:110702131-110702153 CACTTTTGCCCAGCAGAGGCTGG - Intronic
1074152305 10:110768187-110768209 CTCTGATGCCGAGCTGAAGCTGG - Intronic
1075013647 10:118894973-118894995 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1075051159 10:119183155-119183177 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1075061818 10:119261856-119261878 CTCTCATGCCGAGCCGAAGCTGG - Intronic
1075108697 10:119560392-119560414 CTCTGATGCCCAGCCCAAGCTGG - Intergenic
1075137364 10:119796035-119796057 CTCTGATGCCCAGCCGAAGCTGG - Intronic
1075181606 10:120215999-120216021 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1075243239 10:120797979-120798001 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
1075407449 10:122204115-122204137 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1075599413 10:123756449-123756471 CTCTGCTGCCCAGCTGGGGAGGG - Intronic
1075842636 10:125517807-125517829 CTCTGATGTCGAGCTGAAGCTGG + Intergenic
1076011905 10:126995597-126995619 CTCTGATGCCGAGCCAAGGCTGG - Intronic
1076914491 10:133415123-133415145 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1077397381 11:2331796-2331818 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1077493032 11:2870855-2870877 CTCTGGTGCTCACCTGAGGCTGG - Intergenic
1077680615 11:4237210-4237232 CTCTGCTGCCAAGCTGAGGCTGG + Intergenic
1077684893 11:4282608-4282630 CTCTGATGCCAAGCTGAGGCTGG + Intergenic
1077690297 11:4335322-4335344 CTCTGATGCCAAGCTGAGGCTGG - Intergenic
1077836920 11:5934055-5934077 CTCTCATGCTGAGCCGAAGCTGG + Intronic
1077839513 11:5960298-5960320 CTCTGATGCCCAGCTGAGGCTGG + Intergenic
1078122254 11:8522830-8522852 CTCTGATGCCCAGCCGAGGCTGG + Intronic
1078176717 11:8977406-8977428 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1079018180 11:16887432-16887454 CTCCGATGCCGAGTCGAAGCTGG + Intronic
1079020432 11:16906359-16906381 CCCTGATGCCGAGCCAAAGCTGG + Intronic
1079173762 11:18120496-18120518 CTCTAATGCCGAGCCGAAGCTGG + Intronic
1079372169 11:19860988-19861010 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1079444664 11:20547786-20547808 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1079479429 11:20864065-20864087 CTCTGATGCCCAGCCGAGGCTGG - Intronic
1080097774 11:28429406-28429428 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1080283437 11:30584641-30584663 CTGTGATGCCCGACCGAGGATGG - Intronic
1080395117 11:31882977-31882999 CTCTGATTGCCAGCCGGGGCTGG + Intronic
1080405122 11:31971968-31971990 CTCTGATGCGCAGCAGAAGCTGG - Intronic
1080538237 11:33243125-33243147 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1080620727 11:33985592-33985614 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1080772236 11:35352474-35352496 CTCTGGGGCTCAGCCAAGGCAGG - Intronic
1080859907 11:36143967-36143989 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1081288501 11:41303136-41303158 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1081576971 11:44324908-44324930 CTCTGATGTTCAGTCCAGGCTGG + Intergenic
1081627164 11:44662980-44663002 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1081703351 11:45165511-45165533 CTCAGATGCCCAGCCCAGGCGGG + Intronic
1081950598 11:47039425-47039447 CTCTGATGCGGAGCTGAAGCTGG - Intronic
1082064938 11:47892328-47892350 CTCTGATGCCGAGTGGAGGCTGG + Intergenic
1082166609 11:48956483-48956505 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1082233902 11:49799162-49799184 CTCTGATGCCGAGCGGAAGCTGG - Intergenic
1082259087 11:50063714-50063736 CTCTGATGCCAAGCCGAAGCTGG - Intergenic
1082706059 11:56496599-56496621 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
1082844955 11:57717660-57717682 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1083042121 11:59699085-59699107 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
1083079335 11:60073892-60073914 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1083114825 11:60450734-60450756 CTCTCATGCTGAGCCGAAGCTGG + Intronic
1083118741 11:60490966-60490988 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1083120643 11:60509642-60509664 CCCTCATGCCCAGCCGAGGCTGG + Intergenic
1083130546 11:60621415-60621437 CTCTGATACCGAGCCGAAGCTGG + Intergenic
1083154438 11:60814519-60814541 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1083208421 11:61167212-61167234 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1083382127 11:62277969-62277991 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1083646363 11:64173404-64173426 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1083664250 11:64266003-64266025 CGCAGAGGCCCAGCGGAGGCTGG + Exonic
1083831887 11:65238667-65238689 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1083918155 11:65763626-65763648 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
1084338563 11:68476420-68476442 CTCTGATGCCCAGCCGAAGCTGG - Intronic
1084388651 11:68860887-68860909 CTCTGATGCTGAGCTGAAGCTGG + Intergenic
1084624611 11:70296639-70296661 CTCTGATGCTGAGCCGAAGCTGG - Intronic
1084633486 11:70373255-70373277 CTCTGTAGCCCAGGCTAGGCTGG + Intronic
1084745871 11:71168755-71168777 CTCTGATGCCGAGCTGAAGCTGG - Intronic
1084839096 11:71830865-71830887 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1084924976 11:72503487-72503509 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1085073573 11:73571284-73571306 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1085097652 11:73774459-73774481 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
1085126621 11:74006462-74006484 TTCTCAGGCCCAGCCCAGGCAGG - Intronic
1085139846 11:74130030-74130052 CTCTGATGCCGAGCTGAAGCTGG - Intronic
1085141728 11:74150456-74150478 CTCTGTAGCCCAGCCCAGGCTGG - Intronic
1085159516 11:74327844-74327866 CTCTGAGGCCCAGCCTAGGCTGG + Intergenic
1085360290 11:75878818-75878840 CTCTGATGCCGAGCTGAAGCTGG - Intronic
1085443498 11:76583264-76583286 CTCTGATCCCGAGCCGAAGCTGG - Intergenic
1085480716 11:76820840-76820862 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1085492656 11:76934642-76934664 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1085563036 11:77489487-77489509 CTCTGATGCCAAGCCGAAGCTGG + Intergenic
1086017054 11:82181241-82181263 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1086104304 11:83132667-83132689 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1086122769 11:83317754-83317776 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1086341384 11:85852412-85852434 CTCTGATACCCAGCGGAAGCTGG + Intergenic
1086359291 11:86040400-86040422 CTCTGTTGCCCAGGCTAGTCTGG + Intronic
1086365887 11:86109862-86109884 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1086365915 11:86109977-86109999 CTCTGATGCTGAGCCGAAGCTGG + Intergenic
1086430363 11:86731604-86731626 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1086434987 11:86771425-86771447 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1086446678 11:86878301-86878323 CACTGATGCCCAGCCGAAGCTGG + Intronic
1086697094 11:89860061-89860083 CTCTGATCCCTAGCCGAAGCTGG + Intergenic
1086709064 11:89984426-89984448 CTCTGATCCCTAGCCGAAGCTGG - Intergenic
1086792671 11:91062894-91062916 CTCTGATGCCGAGCGGAAGCTGG + Intergenic
1086881327 11:92156940-92156962 TTCTGATGCCGAGCCGAAGCTGG + Intergenic
1087057536 11:93948193-93948215 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1087198485 11:95322023-95322045 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1087214593 11:95481856-95481878 CTCTCATGCCTAGCCGAAGCTGG + Intergenic
1087487142 11:98770712-98770734 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1088116438 11:106318223-106318245 CTCTGATGCCAAGCCGCAGCTGG - Intergenic
1088256959 11:107911843-107911865 CTCTGATACCGAGCCGAAGCTGG + Intronic
1088458036 11:110053137-110053159 CTCTGTTGCCTAGCCCAGGCTGG + Intergenic
1088659101 11:112027857-112027879 CTCTGATGCTGAGCCGAAGCTGG - Intronic
1089148305 11:116346441-116346463 CTCTGATGCTGAGCCGAAGCTGG + Intergenic
1089421278 11:118332683-118332705 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1089585809 11:119508829-119508851 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1090152937 11:124404070-124404092 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1090322741 11:125862257-125862279 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1090411041 11:126509955-126509977 CTCTGTTGTCCAGTCCAGGCTGG - Intronic
1090762333 11:129848470-129848492 CTTTCATGCCGAGCCGAAGCTGG - Intronic
1090777642 11:129979389-129979411 CTCTGCAGCCCACCAGAGGCTGG - Intronic
1090785623 11:130044838-130044860 CTCTGATGCAGAGCTGAAGCTGG - Intergenic
1090907057 11:131085103-131085125 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1091378411 12:41296-41318 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1091437112 12:481480-481502 CTCCAGTGCCCAGCTGAGGCTGG + Intronic
1091586045 12:1817522-1817544 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1092185830 12:6477813-6477835 CTCTGAGGCCAAGCTGAAGCTGG + Intergenic
1092296199 12:7200847-7200869 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1092331641 12:7591101-7591123 CTCTGATGCTGAGCCAAAGCTGG - Intergenic
1092354349 12:7782258-7782280 CTATGTTGCCCAGCCCAGGCTGG - Intergenic
1092401620 12:8183446-8183468 CTCTGATGCCGAGCTGAAGCTGG + Intronic
1092453377 12:8624395-8624417 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1092828022 12:12415507-12415529 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1092843672 12:12565448-12565470 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1092850163 12:12618996-12619018 CTCTGATGCCCAGCTGAGGCTGG - Intronic
1092926122 12:13274146-13274168 CTCTGTCGCCCAGCCGTGCCTGG + Intergenic
1093038361 12:14354111-14354133 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1093927686 12:24925628-24925650 CTCTGATGCCAAGCCGAAGCTGG + Intronic
1094103089 12:26784389-26784411 CTCTGATGCCGAGCCAAGGCTGG + Intronic
1094209256 12:27873370-27873392 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1094670518 12:32563958-32563980 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1095068990 12:37815865-37815887 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1095114051 12:38331230-38331252 CTCTGATGCCCAGCCGAAGCTGG - Intergenic
1095281261 12:40353941-40353963 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1095570918 12:43684407-43684429 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1096039577 12:48501466-48501488 CTCTCATGCTGAGCCGAAGCTGG - Intergenic
1096044515 12:48551277-48551299 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
1096063812 12:48724104-48724126 CTCTGATGGCAAGCCGAAGCTGG + Intergenic
1096082240 12:48841499-48841521 CTCTGATGCTGAGCCAAAGCTGG + Intronic
1096093176 12:48916557-48916579 CTCTCATGCCGAGCCGAAGCTGG - Intronic
1096167731 12:49437786-49437808 CCCTGATGCCGAGCCAAAGCTGG - Intronic
1096224812 12:49860271-49860293 CTCTGATGCCGAGCAGAAGCTGG + Intergenic
1096355143 12:50934777-50934799 CTCTGGTGCCCAGCCCTGTCTGG - Intergenic
1096358984 12:50967225-50967247 CTCTTAAGCCCAGAAGAGGCAGG - Intronic
1096556860 12:52409110-52409132 CCCTGATGCCGAGCCAAAGCTGG + Intergenic
1096773320 12:53950024-53950046 CTCTGATACCTTGGCGAGGCCGG + Intergenic
1096856824 12:54489200-54489222 CTCTGATGCCGAGCAGAAGCTGG - Intergenic
1096951778 12:55480028-55480050 CTCTGATGCTGAGCCCAAGCTGG - Intergenic
1096968817 12:55649115-55649137 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1097028699 12:56076683-56076705 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1097082075 12:56439426-56439448 CTCTGTTGACCAGCCCAGGTTGG + Intronic
1097110212 12:56652394-56652416 CTCTGAAGCCGAGCCGAGGTTGG - Intergenic
1097127273 12:56784634-56784656 CTCTGATGCCGAGCGGAAGCTGG - Intronic
1097128272 12:56790510-56790532 CTCTGATGCCAAGCTGAAGCTGG - Intergenic
1097148950 12:56962885-56962907 CTCTGATGCCGAGCGGAAGCTGG + Intergenic
1097228774 12:57495957-57495979 CTCTGATGCCGAGCCGAGGCCGG - Intronic
1097230702 12:57508618-57508640 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1097779405 12:63686196-63686218 CTCTGATGCCGAGCGGAAGCTGG + Intergenic
1098018794 12:66133971-66133993 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1098333282 12:69375859-69375881 CTCTGATGCCGAGCCCAGGCTGG - Intronic
1098371073 12:69760337-69760359 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1098379694 12:69854302-69854324 CTCTGATGCCCAGCCGAGGCTGG - Intronic
1098412441 12:70201169-70201191 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
1098774038 12:74588890-74588912 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1098883580 12:75941081-75941103 CACTGATGCCGAGCCGAAGCTGG + Intergenic
1099255697 12:80308924-80308946 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1099644154 12:85329259-85329281 CTCTGTTGCCCAGTCCGGGCTGG + Intergenic
1099971197 12:89503153-89503175 CTCTGATGCCCAGCCGAAGCTGG + Intronic
1100048098 12:90410610-90410632 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
1100507715 12:95236380-95236402 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1100570918 12:95842333-95842355 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1100581852 12:95946664-95946686 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1100606749 12:96158143-96158165 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1100995417 12:100295656-100295678 CTCTCATGCCCAGCCGGAGCTGG - Intronic
1101878882 12:108613244-108613266 CTATGTTGCCCAACCCAGGCTGG + Intergenic
1101879296 12:108615458-108615480 CTATGTTGCCCAACCCAGGCTGG - Intergenic
1101885032 12:108655424-108655446 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1102089179 12:110172425-110172447 CTCTGATGCCGAGCTGAAGCTGG + Intronic
1102138245 12:110593061-110593083 CTTTGTTGCCCAGGCCAGGCTGG - Intergenic
1102175165 12:110868678-110868700 CTCTCATGCGGAGCCGAAGCTGG - Intronic
1102294372 12:111724751-111724773 CTCTCATGCCGAGCCGAAGCTGG - Intronic
1102323134 12:111956552-111956574 CTCTAATGCCGAGCCGAGGCTGG + Intronic
1103045239 12:117730547-117730569 CTCTGATGCTGAGCCGAGGCTGG + Intronic
1103234665 12:119361093-119361115 CTCTCATGCCAAGCCGAAGCTGG - Intronic
1103300052 12:119919682-119919704 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1103414229 12:120733179-120733201 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1103456877 12:121075376-121075398 CCCTGATGCCGAGCCAAAGCTGG + Intergenic
1103536072 12:121634662-121634684 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1103537108 12:121640690-121640712 CTCTGTTGCCCAAGCTAGGCTGG - Intronic
1103591097 12:121993016-121993038 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1103641542 12:122356676-122356698 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1103872811 12:124102900-124102922 TTCTGATGCCGAGCCGAAGCTGG - Intronic
1104029413 12:125053645-125053667 TACTGATGCCGAGCCGAAGCTGG - Intergenic
1104542216 12:129676498-129676520 CTTTGAAGCCAAGCCGATGCTGG - Intronic
1104713027 12:130998131-130998153 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1104861584 12:131927023-131927045 CTCTGATGCCGAGCGGAAGCTGG - Intergenic
1105248350 13:18673358-18673380 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1105367531 13:19778420-19778442 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1105527242 13:21187360-21187382 CTCTCATGCTGAGCCGAGGCCGG - Intergenic
1105692998 13:22859859-22859881 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1105921934 13:24971141-24971163 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1105976983 13:25481113-25481135 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1105980732 13:25513914-25513936 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1106104599 13:26723197-26723219 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1106495074 13:30269120-30269142 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1106560371 13:30840550-30840572 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1106679986 13:31999518-31999540 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1106746648 13:32715697-32715719 CTCTGATGCTGAGCCAAAGCTGG + Intronic
1106799378 13:33241579-33241601 CTCTGATGCCGAGCCGAGGCTGG + Intronic
1106961731 13:35006780-35006802 CTCTGTTGCCCAGGCCAGGCTGG + Intronic
1107042696 13:35966543-35966565 CTCTGATGCTGAGCGGAGGCTGG + Intronic
1107165669 13:37279691-37279713 CCCTGATGCCGAGCCGAAGCTGG + Intergenic
1107279960 13:38722258-38722280 CTCTGTTGCCCAGGCTAGTCTGG + Intronic
1107492946 13:40899787-40899809 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1107498703 13:40954486-40954508 CCCTGATGCCGAGCCAAAGCTGG + Intronic
1107589073 13:41882761-41882783 CTCTGATGCCCAGCCGAAGCTGG - Intronic
1107692309 13:42965832-42965854 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1107863680 13:44683356-44683378 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1107953518 13:45486258-45486280 CTCTCATGCCGAGCCGAAGCTGG - Intronic
1108024278 13:46162338-46162360 CTCTGATGCCGAGCAGAAGCTGG + Intronic
1108330067 13:49377440-49377462 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1108347996 13:49565053-49565075 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1108370179 13:49761277-49761299 CTCTAATGGCGAGCCGAAGCTGG + Intronic
1108501803 13:51077188-51077210 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1108608393 13:52063111-52063133 CTCTGATGCCGAGCTGAAGCTGG + Intronic
1108610357 13:52079338-52079360 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1108685733 13:52817511-52817533 CTCTGATACCAAGCGGAGGCTGG + Intergenic
1110092928 13:71477148-71477170 CTCTGTTGCCCAGCCCAGGCTGG + Intronic
1110506571 13:76294728-76294750 CTCTGATGCCAAGCCAAGGCTGG + Intergenic
1111230765 13:85341463-85341485 CTCAGATGCCGAGCGGAGGCTGG - Intergenic
1111368869 13:87289463-87289485 CTCTGTTGCCCGGGCCAGGCTGG - Intergenic
1111388459 13:87561132-87561154 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1111560031 13:89932733-89932755 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1112054396 13:95677120-95677142 CTCTGGAGCCCAGCAGAGGAAGG - Exonic
1112056333 13:95692012-95692034 CTCTGATGCCGAGCTGAAGCTGG - Intronic
1112070706 13:95846382-95846404 CTCTGATGCCCAGCCGAGGCTGG - Intronic
1112077434 13:95929151-95929173 CTCTGATGCCAAGCCGAGGCTGG - Intronic
1112914191 13:104525676-104525698 CTCTGAGACCCCACCGAGGCTGG + Intergenic
1113193835 13:107782092-107782114 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1113328967 13:109310936-109310958 CTCTGATGCCCAGCTGAGGCTGG + Intergenic
1113479153 13:110607243-110607265 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1113588124 13:111479624-111479646 CTCTGAGGCCCTGCAGACGCAGG + Intergenic
1113679058 13:112229653-112229675 CCCTGGTGTCCAGCCGAGCCTGG - Intergenic
1113735907 13:112678996-112679018 CTCTGATGCTGAGCCGAGGCTGG - Intronic
1114137099 14:19865749-19865771 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
1114165013 14:20212098-20212120 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
1114174625 14:20309381-20309403 CTCTGATGCCGAGCCGAAACTGG + Intergenic
1114198938 14:20505352-20505374 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1114336539 14:21697328-21697350 CTCTGATGCCGAGCGGAGGCTGG + Intergenic
1114427507 14:22636449-22636471 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
1114507739 14:23231678-23231700 CTCTGATGCTGAGCCGAAGCTGG + Intronic
1114578603 14:23736368-23736390 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1115259616 14:31438131-31438153 CTCTGATGCCAAGCCGAAGCTGG - Intronic
1115494051 14:33985045-33985067 CTCTGATGCCGAGCCGAGGCTGG - Intronic
1115539982 14:34411342-34411364 CTCTGATGCTGAGCCGAAGCTGG + Intronic
1115547300 14:34475500-34475522 CTCTGATGCCGAGCAGAGGCTGG + Intergenic
1115622478 14:35153347-35153369 CTCTGATGCGGAGCTGAAGCTGG - Intronic
1115689109 14:35825540-35825562 CACTGATGCCGAGCCGAAGCTGG - Intergenic
1115703906 14:35978590-35978612 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1116005517 14:39286402-39286424 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1116192207 14:41675560-41675582 CTCTGATGCCAAACCGAAGCTGG - Intronic
1116408971 14:44600854-44600876 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1116840953 14:49820656-49820678 CTCTCATGCCGAGCCAAAGCTGG + Intronic
1116959782 14:50957189-50957211 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1117010779 14:51468248-51468270 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1117207895 14:53463457-53463479 CTCAGATGGGCAGGCGAGGCTGG - Intergenic
1117276843 14:54202657-54202679 CTCTGATGCCAAGCCGAAGCTGG + Intergenic
1117596720 14:57333128-57333150 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1117763816 14:59059624-59059646 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1118148437 14:63164874-63164896 CTCTTATGCCGAGCCAAAGCTGG + Intergenic
1118184002 14:63521982-63522004 CTCTGATACCGAGCCGAAGCTGG + Intronic
1118209500 14:63752015-63752037 CTCTGATGCTGAGCCAAAGCTGG - Intergenic
1118239155 14:64038800-64038822 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1118253424 14:64183873-64183895 CTCTGATGCTGAGCCAAAGCTGG - Intronic
1118341412 14:64896638-64896660 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1118423392 14:65633057-65633079 CTCTGATGCTGAGCCGAAGCTGG + Intronic
1118428779 14:65693472-65693494 CTGTGATGCCGAGCTGAAGCTGG - Intronic
1118517890 14:66546729-66546751 CTCTGATACCGAGCTGAAGCTGG - Intronic
1118584545 14:67340712-67340734 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1118890201 14:69902655-69902677 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1118955447 14:70477004-70477026 CTCCGATGCGGAGCCGAAGCTGG + Intergenic
1119254750 14:73185552-73185574 CTCTCATGCTGAGCCGAAGCTGG - Intronic
1119480246 14:74954287-74954309 CTCTGGCACCCAGCCAAGGCGGG - Intronic
1119595151 14:75926007-75926029 CTCTGATGCCAAGGCGAAGCTGG - Intronic
1119698780 14:76735432-76735454 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1119700150 14:76749666-76749688 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
1119804686 14:77475155-77475177 CCCTGATGGCCAGCAGAGGAAGG - Exonic
1119835582 14:77746955-77746977 CTCTGATGCTGAGCCGAGGCTGG + Intronic
1119868675 14:77994484-77994506 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1120086936 14:80286036-80286058 CTCTGATGCCAAGCCGAAGCTGG + Intronic
1120170696 14:81245206-81245228 CTCTGATACCCATACGAGGCTGG - Intergenic
1120505940 14:85353427-85353449 CTCTGATGCCGAGCAGAAGCTGG - Intergenic
1120547745 14:85830588-85830610 CTCTGATGCCGAGCAGAAGCTGG - Intergenic
1120892717 14:89505313-89505335 CTCTGATGCCGAGCCGAGGCTGG + Intronic
1121143062 14:91558304-91558326 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1121306963 14:92912637-92912659 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1121531430 14:94657462-94657484 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1122212144 14:100180327-100180349 CTCTGATGCGGAGCCAAAGCTGG + Intergenic
1122238052 14:100344121-100344143 CTCTGATGCGGAGCCAAAGCTGG + Intronic
1122568703 14:102678160-102678182 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1122957916 14:105080003-105080025 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1202847970 14_GL000009v2_random:199467-199489 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
1202917452 14_GL000194v1_random:190020-190042 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
1124191840 15:27585760-27585782 CTCTGTTGCCCAGGCTAGGCTGG + Intergenic
1124335236 15:28850598-28850620 CTCTGATGCTGTGCCGAAGCTGG - Intergenic
1124607735 15:31184006-31184028 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1125459825 15:39895177-39895199 CTCTCATGCTGAGCCGAAGCTGG - Intronic
1125566394 15:40682135-40682157 CTCTGATGCTGAGCCAAAGCTGG + Intergenic
1125651301 15:41320316-41320338 CTCTGATGCCAAGCCAAAGCTGG + Intronic
1125862646 15:43013920-43013942 CTCTGATGCCGAGCTGAAGCTGG + Intronic
1125868328 15:43076013-43076035 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1125878178 15:43168081-43168103 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1126125875 15:45293908-45293930 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1126210863 15:46098757-46098779 CTCTGATGCCAAGCCCAGGCTGG - Intergenic
1126295209 15:47131788-47131810 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1126378416 15:48020073-48020095 CTATGTTGCCCAGGCTAGGCTGG - Intergenic
1126571473 15:50157793-50157815 CTCTGATGCCAAGCCAAAGCTGG + Intronic
1126573029 15:50172181-50172203 CTCTGATGCCGAGCGGAGGCTGG + Intronic
1126691675 15:51293595-51293617 CTCTGATGCCGATCCAAAGCTGG + Intronic
1126752079 15:51886623-51886645 CTCTGATGCCCAGCCGAGGCTGG - Intronic
1126799289 15:52285522-52285544 CTCTGATGCAGAGCTGAAGCTGG + Intronic
1126816681 15:52460603-52460625 CTCTGATGCCGAGCCGAGGCTGG - Intronic
1127153935 15:56109084-56109106 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1127584094 15:60365887-60365909 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1127644525 15:60946306-60946328 CTCTGATGACGAGCCGAAGCGGG + Intronic
1127783129 15:62333248-62333270 CTCTGATGCCCAGCCGAAGCTGG - Intergenic
1127824504 15:62690971-62690993 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1127874151 15:63098313-63098335 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1128059092 15:64722704-64722726 CTGTGTTGCCCAGCCCAGGCTGG + Intergenic
1128071518 15:64800002-64800024 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1128490411 15:68136550-68136572 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1128587333 15:68861051-68861073 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1128597634 15:68965473-68965495 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1129008581 15:72395893-72395915 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
1129054308 15:72808026-72808048 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1129286975 15:74533417-74533439 CTCTGATGGGAAGCTGAGGCAGG - Intergenic
1129313615 15:74728310-74728332 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1129438094 15:75558567-75558589 CTCTGACGCCGAGCCGAAGCTGG + Intronic
1129933805 15:79432676-79432698 CTCCGGGGCCAAGCCGAGGCAGG - Intronic
1130341003 15:82999117-82999139 CTCTGATGCCAAGCCAAAGCTGG - Intronic
1130428529 15:83823153-83823175 CTCTGATGCCAAGCCAAAGCTGG - Intronic
1130522262 15:84672305-84672327 CTCTGATGCCGAGTCGAAGCTGG + Intronic
1130946891 15:88554425-88554447 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1131001580 15:88942657-88942679 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1131044031 15:89297708-89297730 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1131127006 15:89867061-89867083 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1131141058 15:89977528-89977550 CTCTCATGCCGAGCTGAAGCTGG + Intergenic
1132300925 15:100774953-100774975 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1132921983 16:2400720-2400742 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1132992413 16:2802828-2802850 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1132997127 16:2829259-2829281 GTCAGATGCCCAAGCGAGGCGGG - Intergenic
1133365202 16:5203700-5203722 TTCTGATGCCGAGCCGAAGCTGG - Intergenic
1133680258 16:8114452-8114474 CGCTGATGCCGAGCCAAAGCTGG + Intergenic
1133752252 16:8733778-8733800 CTCTCATGCTGAGCCGAAGCTGG - Intronic
1133786987 16:8981514-8981536 CTCTGATGCTGAGCCGAAGCTGG + Intergenic
1134049672 16:11128619-11128641 CTCTGGTGCCAAGCCAAGGTGGG - Intronic
1134082931 16:11336660-11336682 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1134154464 16:11831616-11831638 CTCTGTCGCCCAGCCCAGGCTGG + Intergenic
1134471978 16:14533363-14533385 CTCTGATGCCAAGCCGAAGCTGG - Intronic
1134750298 16:16619798-16619820 CTCTGATGCCAAGCCAAGGCTGG - Intergenic
1134854456 16:17506767-17506789 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1134995160 16:18733800-18733822 CTCTGATGCCAAGCTGAGGCTGG + Intergenic
1135575476 16:23582855-23582877 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1135639858 16:24110053-24110075 CTCTCATGCTGAGCCGAAGCTGG - Intronic
1135694682 16:24575720-24575742 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1136134854 16:28249539-28249561 CTCAGATGCCCAGCCCAGCGGGG - Intergenic
1136155028 16:28376767-28376789 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1136160391 16:28415895-28415917 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1136165018 16:28447998-28448020 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1136197947 16:28666982-28667004 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1136202704 16:28699419-28699441 CTCTCATGCGGAGCCGAAGCTGG - Intronic
1136208064 16:28738495-28738517 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1136214294 16:28781159-28781181 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1136259014 16:29061004-29061026 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1136571966 16:31103669-31103691 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
1136593402 16:31231643-31231665 CTCTGATGCCGAGCGGAAGCTGG + Intergenic
1136919194 16:34246824-34246846 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1137240951 16:46654081-46654103 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1137283704 16:46999496-46999518 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
1137303736 16:47180421-47180443 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1137430954 16:48417460-48417482 CTCTGATGCCGAGCCCAAGGTGG - Intronic
1137439204 16:48483803-48483825 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1137493325 16:48951145-48951167 CTCTCATGCTGAGCCGAGGCTGG + Intergenic
1137523178 16:49211160-49211182 CTCTGATGCCCAGCCGAAGCTGG - Intergenic
1138043230 16:53697400-53697422 CTCTGATGCCAAGCCGAAGCTGG + Intronic
1138400735 16:56740972-56740994 CTCTCATGCGGAGCCGAAGCTGG - Intronic
1138435505 16:56997302-56997324 GCCTGATGCCCAGCCTATGCCGG + Intronic
1138467438 16:57201916-57201938 CCCTGATGCCAAGCCAAAGCTGG - Intronic
1138642745 16:58397764-58397786 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1138699487 16:58847005-58847027 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1139018139 16:62714904-62714926 CTCTGTTGCCCAGGCTGGGCTGG + Intergenic
1139132343 16:64161669-64161691 CTCTAATACCCAGCCAGGGCTGG + Intergenic
1139378227 16:66514158-66514180 CTCTGATGCCCAGCCGAGGCTGG + Intronic
1139394603 16:66630377-66630399 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1139556172 16:67712324-67712346 CTCTGATGCCGAGCCAAGGCTGG + Intronic
1139623377 16:68164348-68164370 CTCTGATACCGAGCCGAAGCTGG - Intronic
1139864030 16:70050365-70050387 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1139885281 16:70203911-70203933 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1139888120 16:70225414-70225436 CTCTCATGCCAAGCCGAAGCTGG - Intergenic
1140063143 16:71588877-71588899 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
1140224803 16:73068565-73068587 CTAGTATGGCCAGCCGAGGCTGG - Intergenic
1140993927 16:80242591-80242613 CTCTCATGCTGAGCCGAAGCTGG + Intergenic
1141701497 16:85644307-85644329 CTCTGCTGCCCAGGCTGGGCTGG - Intronic
1141728887 16:85808932-85808954 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1142011653 16:87718408-87718430 CTCTGATGCCGAGCGGAGGCTGG + Intronic
1142112687 16:88340724-88340746 TGCTGATTCCCAGCCCAGGCAGG - Intergenic
1142129864 16:88427650-88427672 CCCCGAGGCCCAGCCAAGGCAGG + Exonic
1142146962 16:88496702-88496724 CTCTGATGCCCAGCAGTGTGTGG - Intronic
1142393470 16:89817129-89817151 CTCTGTTGCCCAGGCTAGTCTGG - Intergenic
1142529705 17:571581-571603 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1142533450 17:598010-598032 CTCTCATGCTGAGCCGAAGCTGG + Intronic
1142592323 17:1011817-1011839 CTGGGAGGCCCAGCCGGGGCAGG - Intronic
1142629448 17:1215277-1215299 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1142634414 17:1247852-1247874 CTCTGATGCCGAACCGAAGCTGG - Intergenic
1142657558 17:1403977-1403999 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1142705417 17:1690566-1690588 CTCTCATGCTGAGCCGAAGCTGG - Intergenic
1142818402 17:2446648-2446670 CTCTGATGCCGAGCCAAGGCTGG + Intronic
1142913357 17:3113563-3113585 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1142940052 17:3372781-3372803 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1142949051 17:3464019-3464041 CTCTCATGCCAAGCCGAAGCTGG + Intronic
1142963354 17:3564964-3564986 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1143008677 17:3853689-3853711 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
1143104082 17:4519755-4519777 CTTGGAGGCCCAGCCCAGGCTGG + Intronic
1143115398 17:4578983-4579005 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1143277359 17:5721858-5721880 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1143342639 17:6225703-6225725 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1143653470 17:8278898-8278920 GTCTGATGGAGAGCCGAGGCAGG - Intergenic
1143667545 17:8373213-8373235 CTCTGATGCCAAGCCGAGGCTGG + Intronic
1143689497 17:8549737-8549759 CTCTCATGCTGAGCCGAGGCTGG + Intronic
1143973206 17:10810828-10810850 CTCTACTGCCCAGGCCAGGCTGG + Intergenic
1144509857 17:15866772-15866794 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1144509866 17:15866823-15866845 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1144536214 17:16094603-16094625 CTCTCATGCCGAGCCAAAGCTGG + Intronic
1144559945 17:16312878-16312900 TTCTGATGCTGAGCCGAAGCTGG - Intronic
1144799146 17:17913144-17913166 CTCTCATGCCGAGCCGAAGCTGG - Intronic
1144808040 17:17980314-17980336 CTCTGCCGCCCAGCCCAGGCTGG + Intronic
1144860262 17:18297488-18297510 CTCTGATGCCGAGCTGAAGCTGG + Intronic
1144866225 17:18337610-18337632 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1145022113 17:19440858-19440880 CACTGATGCCGAGCCGAAGCTGG + Intergenic
1145026929 17:19475396-19475418 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1145047451 17:19628840-19628862 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1145158258 17:20556993-20557015 CTCTGATGCCCAGCTGAGGCTGG + Intergenic
1145173962 17:20684391-20684413 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1145173971 17:20684442-20684464 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1145417955 17:22740547-22740569 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1145684080 17:26637579-26637601 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1145717031 17:27033170-27033192 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1145733486 17:27211429-27211451 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1145895982 17:28458221-28458243 CTCTGATGCCGAGCGGAAGCTGG + Intronic
1145920415 17:28605212-28605234 CTCTCATGCCGAACCGAAGCTGG - Intronic
1146049030 17:29533798-29533820 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1146155737 17:30522854-30522876 CTCTGATGCCGAGCCGAAGCTGG + Exonic
1146187806 17:30736695-30736717 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1146216586 17:30981317-30981339 CTCTGATGCTGAGCCAAAGCTGG - Intronic
1146444668 17:32923778-32923800 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1146731448 17:35195960-35195982 CTCTGATGCGGAGCCGAAGCTGG - Intergenic
1146857591 17:36266590-36266612 CTCTGTTGCCTAGGCCAGGCTGG + Intronic
1147076384 17:37991124-37991146 CTCTGTTGCCTAGGCCAGGCTGG + Intronic
1147077419 17:38001935-38001957 CTCTGTTGCCTAGGCCAGGCTGG - Intronic
1147087909 17:38070669-38070691 CTCTGTTGCCTAGGCCAGGCTGG + Intergenic
1147109301 17:38249844-38249866 CTCTGTTGCCTAGGCCAGGCTGG - Intergenic
1147172454 17:38630269-38630291 CTCTGATGCTGAGCCGAAGCTGG + Intergenic
1147277738 17:39333184-39333206 CTCTGATGCCCAGCCGAGGCTGG + Intronic
1147278265 17:39337024-39337046 CTCTGATGCTGAGCCGAAGCTGG + Intronic
1147622185 17:41875480-41875502 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1147708891 17:42448531-42448553 CTCTGAGGCCGAGCCGAAGCTGG + Intergenic
1147784904 17:42972371-42972393 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1147974014 17:44237455-44237477 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
1148016163 17:44524063-44524085 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
1148034834 17:44652051-44652073 CTCTGCTGCCCAGCGTAGACTGG - Intergenic
1148404103 17:47397050-47397072 CTCTCATGCCGAGCCGAAGCTGG + Intronic
1148406300 17:47419986-47420008 CTCTGATGCCGAGCGGAAGCTGG + Intronic
1148420149 17:47538240-47538262 CTCTGTTGCCTAGGCCAGGCTGG + Intronic
1149597150 17:57871061-57871083 CTCTGAAGCCCAGCAGTGGCTGG + Intronic
1149607302 17:57934058-57934080 CTATGTTGCCCAGCCCAGGCTGG - Intronic
1149625266 17:58075170-58075192 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1149632870 17:58141867-58141889 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1149780806 17:59395046-59395068 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1149793463 17:59499492-59499514 CTCTCATGCCGAGCCGAGGCTGG + Intergenic
1150008846 17:61486773-61486795 CCCTGAGGCCCAGCCAAGGCTGG - Intergenic
1150213758 17:63455878-63455900 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
1150254806 17:63735969-63735991 CTCTGTCGCCCAGGCCAGGCTGG + Intronic
1150380477 17:64716061-64716083 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1150477091 17:65483860-65483882 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1150502109 17:65660747-65660769 CCATGTTGCCCAGCCCAGGCTGG + Intronic
1150518147 17:65836841-65836863 CTCTGATGCCCAGCCGAGGCTGG + Intronic
1150780432 17:68116937-68116959 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1150894781 17:69196971-69196993 CTCTGATGCCAAGCGGAGGCTGG - Intronic
1151242795 17:72771319-72771341 CTCTGTTGCCCAGCTCAGGCTGG - Intronic
1151439361 17:74118308-74118330 CTCAGATGCCCATCGGATGCTGG - Intergenic
1151770448 17:76156994-76157016 CTCTGTTGCCCAGCCCAGGCTGG + Intronic
1152019945 17:77775703-77775725 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1152030668 17:77840704-77840726 CTCTGAGGCTCAACCGAGGAAGG + Intergenic
1152035305 17:77868539-77868561 CTCCAATGCCCAGAGGAGGCTGG + Intergenic
1152128983 17:78464979-78465001 CTCTCATGCTGAGCCGAGGCTGG + Intronic
1152415597 17:80159703-80159725 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1152479071 17:80537986-80538008 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1152672537 17:81617697-81617719 CTCTCATGCCGAGCCGAAGCTGG + Intronic
1153033372 18:735682-735704 CTCTGTTGCCCAGCCCAGGCTGG - Intronic
1153221889 18:2868753-2868775 GTCTGATGCCGAGCCGAAGCTGG - Intronic
1153267845 18:3288715-3288737 CTCTGTCGCCCAGGCCAGGCTGG + Intergenic
1153605624 18:6828308-6828330 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1153633904 18:7097898-7097920 CTCTCATGCTGAGCCGAAGCTGG + Intronic
1153646966 18:7204191-7204213 CTCTGATGCCTAGCTGAGGCTGG - Intergenic
1153667424 18:7378862-7378884 CTCTGTTGCCTTGCCCAGGCTGG + Intergenic
1153872045 18:9330689-9330711 CTCTGCAGCCCAGCAGAGGCAGG - Intergenic
1154089474 18:11344084-11344106 CTCTGATGCCCAGCCAAGGCTGG + Intergenic
1154158008 18:11959090-11959112 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1154264994 18:12873326-12873348 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1154290108 18:13099137-13099159 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1154310125 18:13260904-13260926 CTCTGAATCCCAGCCCAGGGAGG - Intronic
1154398495 18:14011808-14011830 CTCTCATGCCAAGCCGAAGCTGG - Intergenic
1154990448 18:21593547-21593569 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1155956297 18:31959568-31959590 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
1156066488 18:33148381-33148403 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1156326504 18:36078608-36078630 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1157455744 18:47827519-47827541 CTCTGATGCCGAGCCAAGGCTGG + Exonic
1157629641 18:49081461-49081483 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1157705032 18:49799253-49799275 CTCTGATGCCTAGCTGAAGCTGG + Intronic
1157810212 18:50689688-50689710 CTCTGTTGCCCAACCGAGGCTGG - Intronic
1157857875 18:51118038-51118060 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1157994424 18:52538110-52538132 GTCTGATGCCAAGCTGAGGATGG - Intronic
1158148392 18:54342510-54342532 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1158459501 18:57633829-57633851 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1158646751 18:59255017-59255039 CTCTGATGCTGAGCCAAGGCTGG + Intergenic
1159380137 18:67645551-67645573 CTCTGTTGCCCAGCCCAGGCTGG - Intergenic
1159615023 18:70570300-70570322 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1159663536 18:71129665-71129687 CTCTGTCACCCAGCCCAGGCTGG + Intergenic
1160182062 18:76644969-76644991 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1160228558 18:77029368-77029390 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1161180361 19:2876683-2876705 CTCTGTTGCCCAGCCCAGGCTGG - Intronic
1161208054 19:3052290-3052312 CTCTGATGCCTAGCCCAGAGAGG - Intergenic
1161685612 19:5701370-5701392 CTCTGATGCCGAGCCGAGGCTGG + Intronic
1161790061 19:6354861-6354883 CACTGATGCCGAGCCGAAGCTGG + Intergenic
1162163719 19:8738817-8738839 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1162254961 19:9482701-9482723 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1162278815 19:9679379-9679401 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1162515701 19:11146230-11146252 CTCTGGTGCCTAGCAGAGTCTGG + Exonic
1162538341 19:11277445-11277467 CTCTGATGCCGAGCGGAGGCTGG - Intergenic
1162567133 19:11450765-11450787 CTCTGGGGCCCAGGCGGGGCTGG + Exonic
1162602284 19:11677833-11677855 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1162683090 19:12361758-12361780 CTCTGATGCCGAGCGGAGGCTGG + Intronic
1162694922 19:12467176-12467198 CTCTGATGCAGAGCCGAAGCTGG + Intronic
1162763448 19:12903001-12903023 CTCTGTTGCCCAGCCCAGGCTGG - Intronic
1163142887 19:15362396-15362418 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1163190520 19:15673544-15673566 GTCTGAGGCCCAGCCAGGGCAGG - Exonic
1163542077 19:17917662-17917684 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
1163558668 19:18006576-18006598 CTCTCATGCCGAGCAGAAGCTGG - Intronic
1163865393 19:19769532-19769554 CTCTGATGCGGAGCCGAGGCTGG + Intergenic
1163896620 19:20065205-20065227 CTCTGATGCCGAGCAGAAGCTGG - Intergenic
1163904173 19:20137316-20137338 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1163909576 19:20176782-20176804 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1163912963 19:20213935-20213957 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1163921621 19:20295811-20295833 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1163945659 19:20531185-20531207 CTCTCATGCCAAGCCAAAGCTGG - Intergenic
1163986251 19:20953383-20953405 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1164034934 19:21444396-21444418 TACGGATGCCAAGCCGAGGCTGG - Intronic
1164043347 19:21512034-21512056 CTCTGATGCTGAGCCGAAGCTGG - Intronic
1164054882 19:21614330-21614352 CTCTGACGCCCAGCCGAGGCTGG + Intergenic
1164064887 19:21707390-21707412 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1164066278 19:21720387-21720409 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1164071677 19:21775232-21775254 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1164126397 19:22322353-22322375 CTCTGATGCCAAGCCGAGGCTGG - Intergenic
1164168273 19:22701246-22701268 CTCTGATGCCGAGTGGAAGCTGG - Intergenic
1164186354 19:22872356-22872378 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1164217424 19:23161763-23161785 CTCTGATGCCAAGCCGAGGCTGG - Intergenic
1164218507 19:23172605-23172627 CTCTGATGCCAAGCTGAAGCTGG + Intergenic
1164231350 19:23290765-23290787 CTCTGATGCCGAGTGGAGGCTGG - Intergenic
1164244528 19:23418693-23418715 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1164256788 19:23534289-23534311 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1164263777 19:23594197-23594219 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1164301003 19:23963442-23963464 TTCTGATGCTGAGCCGAAGCTGG + Intergenic
1164659468 19:29949867-29949889 CTCTGATGCCAAGCCGAAGCTGG - Intronic
1164719830 19:30424068-30424090 CTCTGAAGCTCAGCTGATGCTGG + Intronic
1165193248 19:34080539-34080561 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1165295583 19:34922969-34922991 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1165482055 19:36069955-36069977 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1165540669 19:36490505-36490527 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1165727876 19:38124959-38124981 CTCTGATCCCGAGCCGAAGCTGG - Intronic
1165852332 19:38856640-38856662 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1166028795 19:40109663-40109685 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1166029603 19:40117228-40117250 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1166115211 19:40649122-40649144 CTCTGATGCTGAGCCAAAGCTGG - Intergenic
1166163262 19:40967398-40967420 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1166268437 19:41699433-41699455 CTCTGATGCCCACACATGGCAGG + Intronic
1166418192 19:42611228-42611250 CTCTGATGCCCAGCCGAAGCTGG - Intronic
1166421629 19:42640495-42640517 CTCTGATGCCCAGCCGAAGCTGG - Intronic
1166640063 19:44488303-44488325 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1166832587 19:45647591-45647613 CTCTGATGCAGAGCTGAAGCTGG + Intergenic
1167038642 19:47009168-47009190 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1167540730 19:50085794-50085816 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1167588865 19:50391654-50391676 CTCTGATGCCGAGCTGAGGCTGG - Intronic
1167627502 19:50602312-50602334 CTCTGTTGCCCAGACGAGGCTGG + Intergenic
1167846907 19:52172054-52172076 ATCTGATGTGCAGCCGTGGCTGG + Intergenic
1167897666 19:52594275-52594297 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1167924347 19:52810928-52810950 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1167937288 19:52919206-52919228 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
1167971218 19:53188539-53188561 CTCTGATGCCGAGCCAAGGCTGG - Intronic
1167975353 19:53222308-53222330 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
1167980415 19:53270627-53270649 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1168572465 19:57482617-57482639 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1168641190 19:58033007-58033029 CTCTGTTGCCCAGGCAAGGCTGG + Intergenic
1168658139 19:58146589-58146611 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1168696396 19:58406304-58406326 CTCTGATGCCGAGCCGAAGCTGG - Intronic
924970804 2:126243-126265 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
925400651 2:3569950-3569972 CTCTGATGCCTAGCCGAAGCTGG - Intergenic
925403793 2:3592205-3592227 CTCTGATGCCGAGCCAAGGCTGG - Intergenic
926252927 2:11165973-11165995 CTCTGATGCCGAGCCGAAGCTGG - Intronic
926322822 2:11760638-11760660 CTCTGATGCCGAGCCGAAGCTGG - Intronic
926675215 2:15612964-15612986 CTCTGATACCGAGCCGAAGCTGG - Intronic
926683502 2:15680993-15681015 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
926724510 2:15986887-15986909 TTGTGATGCCCAGCCCTGGCTGG + Intergenic
927391390 2:22599349-22599371 GTCTGATTGTCAGCCGAGGCTGG + Intergenic
927747071 2:25633202-25633224 CTCTGATGCCGAGCCGAAGCTGG + Intronic
927755487 2:25705123-25705145 CTCTGATGCTGAGCCAAAGCTGG + Intergenic
927777207 2:25911564-25911586 CTCCCATGCCGAGCCGAAGCTGG - Intergenic
927833492 2:26371818-26371840 CTCTCATGCCGAGCCGAAGCTGG - Intronic
928003395 2:27541352-27541374 CTCTGATGCCGAGCCAAAGCTGG - Intronic
928005606 2:27558858-27558880 CTCTGATGCCGAGCCAAGGCTGG - Intronic
928511920 2:32010558-32010580 CGCTGCTGCCCAGCCGGGGCTGG + Intronic
928542359 2:32295024-32295046 CTCTGATGCCGAGCCGAAGCTGG - Intronic
928558274 2:32448608-32448630 CTCTGATGCCGAGCCGAAGCTGG - Intronic
928585676 2:32755540-32755562 CTCTGATGCCGAGCCGAAGCTGG - Intronic
928687332 2:33762148-33762170 CTCCGATGCCAAGCCGAAGCTGG - Intergenic
928722316 2:34133876-34133898 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
928888658 2:36179353-36179375 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
929062194 2:37933729-37933751 CTCTGATGCCGAGCCGAAGCTGG - Intronic
929066256 2:37978277-37978299 CTCTGATGCCGAGCCCAGGCTGG - Intronic
929110508 2:38402734-38402756 CACTGATGCCGAGCTGAAGCTGG + Intergenic
929121463 2:38487435-38487457 CTCTGATGCCCAGGCGGGAGTGG - Intergenic
929121479 2:38487539-38487561 CTCTGATGCCCAGGCGGGAGTGG - Intergenic
929152075 2:38756662-38756684 CTCTAATGCCGAGCCGAAGCTGG - Intronic
929238484 2:39629147-39629169 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
929415832 2:41746127-41746149 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
929445074 2:41995086-41995108 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
929448049 2:42015564-42015586 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
929516431 2:42607026-42607048 CTCTCATGCGGAGCCGAAGCTGG - Intronic
929518054 2:42622363-42622385 CTCTCATGCCGAGCCGAAGCTGG - Intronic
929577928 2:43063965-43063987 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
929650955 2:43678667-43678689 CTCTGATGCCGAGCCGAAGCTGG - Intronic
929690464 2:44068291-44068313 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
929739364 2:44587514-44587536 CTCTGATGCCGAGCCAAAGCTGG + Intronic
930026362 2:47031573-47031595 TTCTGATGCCGAGCTGAGGCAGG - Intronic
930035488 2:47082877-47082899 CTCCCATGCCCAGCCCAGGAGGG + Intronic
930079539 2:47434483-47434505 CCCTGATGCCGAGCCAAAGCTGG - Intronic
930363478 2:50411084-50411106 CTCTGATGCCGAGCGGAGGCTGG + Intronic
930396540 2:50829186-50829208 CTCTGATGCCAAGCCGAAGCTGG - Intronic
930665739 2:54096790-54096812 CTCTGATGCCGAGCCAAGGCTGG - Intronic
930703796 2:54485229-54485251 CTCTGATGCCAAGCCGAAGCTGG + Intronic
930727728 2:54698436-54698458 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
930821291 2:55650208-55650230 CTCTGATGCCGAGCTGAAGCTGG + Intronic
930834118 2:55774688-55774710 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
931479785 2:62629734-62629756 CTCTGATGCCGAGCGGAAGCTGG + Intergenic
931576245 2:63721778-63721800 CTCTCATGCTGAGCCGAAGCTGG + Intronic
931584090 2:63808380-63808402 CTCTGATGCCGAGCCGAAGCTGG + Intronic
931604901 2:64042419-64042441 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
931656473 2:64513166-64513188 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
931783879 2:65601799-65601821 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
932253950 2:70267746-70267768 CTCTGATGCCGAGCCAAGGCTGG - Intronic
932367103 2:71160492-71160514 CTCTGATGCAGAGCCGAAGCTGG + Intergenic
932410424 2:71543819-71543841 CTCTGATGCCGAGCCGAAGCTGG - Intronic
932807695 2:74796988-74797010 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
932903324 2:75724632-75724654 CTCTGATGCAGAGCCGAAGCTGG + Intergenic
933247263 2:79989604-79989626 CTCTGTTGCCCAGACCAGGCTGG - Intronic
934128211 2:88919957-88919979 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
934548924 2:95242888-95242910 CTCTGATGCCCAGCCGAACCTGG + Intronic
934703287 2:96460840-96460862 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
934898081 2:98135858-98135880 CTCTGAGGCCCAGGTGAGGTGGG - Intronic
934998691 2:98989648-98989670 CTCTGATGCCAAGCCAAAGCTGG - Intergenic
935164973 2:100562597-100562619 CTGTGATCCCAGGCCGAGGCGGG - Intergenic
935630987 2:105211873-105211895 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
935636056 2:105250692-105250714 CCCTGATGCCGAGCCAAAGCTGG + Intergenic
936158361 2:110064599-110064621 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
936186300 2:110306727-110306749 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
936345467 2:111672115-111672137 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
936373875 2:111924663-111924685 CCCTGAATCCCAGTCGAGGCAGG - Intronic
937168920 2:119845199-119845221 CTCTCATGCGGAGCCGAAGCTGG - Intronic
937208218 2:120250680-120250702 CTCTGACTCCCAGCAGAGCCAGG - Intronic
937947329 2:127352737-127352759 CTCTGATGCCGAGCCGAAGCTGG + Intronic
938253279 2:129833059-129833081 CTCTGATGTCGAGCCGAGTCTGG + Intergenic
938533636 2:132220402-132220424 CTCTGATGCCGAGCCAAAGCTGG + Intronic
938720486 2:134063451-134063473 CTCCGATGCCGAGCTGAAGCTGG + Intergenic
938771054 2:134501238-134501260 CTCTGAACCCCAGGTGAGGCTGG + Intronic
938822112 2:134969309-134969331 CTCTGATGCCGAGCTGAAGCTGG - Intronic
938829278 2:135034756-135034778 CTCTGATGCCCAGCCGAAGCTGG - Intronic
938836070 2:135105270-135105292 CTCTGATGCCAAGCCGAACCTGG + Intronic
938885583 2:135644473-135644495 CTCTGTTGCCCGGCCCAGGCTGG - Intronic
939477128 2:142701956-142701978 CTCTGATGCCCAGCCTAAGCTGG + Intergenic
939488168 2:142843182-142843204 CTCTGTTGCCCAGACTGGGCAGG - Intergenic
940298983 2:152159767-152159789 CTCTGATGACGAGCCAAAGCTGG + Intronic
940635428 2:156292911-156292933 CTCTCATGCTGAGCCGAGGCTGG + Intergenic
940643100 2:156367599-156367621 CTCTGATGCTGAGCCAAAGCTGG + Intergenic
940652569 2:156452500-156452522 CTCTGATGCCGAGCCGAAGCTGG - Intronic
941024155 2:160440012-160440034 CTCTGATGCCGAGCCGAAGCTGG - Intronic
941024955 2:160448333-160448355 CTCTGATGCCGAGCGGAGGCTGG + Intronic
941197426 2:162469745-162469767 CTCTGATGCCGAGCTGAAGCTGG + Intronic
941768568 2:169326254-169326276 CTCTGATGCCGAGCCGAAGCTGG + Intronic
941793487 2:169576075-169576097 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
941814975 2:169787318-169787340 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
941822516 2:169856789-169856811 CTCTGATGCCAAGCCGAGGCTGG - Intronic
941847605 2:170149076-170149098 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
942012051 2:171774108-171774130 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
942021181 2:171867579-171867601 CTCTGATGCCGAGCCGAAGCTGG - Intronic
942024526 2:171899277-171899299 CTCTGATGCCGAGCCAAAGCTGG + Intronic
942042924 2:172082862-172082884 CTCTGATGCCGAGCCGCTGGCGG - Intergenic
942096014 2:172537231-172537253 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
942113042 2:172700960-172700982 CTCTGATGCCAAGCCGAGGCTGG - Intergenic
942355495 2:175107604-175107626 CTCTGATGCCGAGCCAAAGCTGG + Intronic
942361881 2:175181337-175181359 CTCTGGTGCGTAGCCCAGGCAGG - Exonic
942621192 2:177845977-177845999 CTCTCATGCCGAGCCGAAGCTGG - Intronic
943005624 2:182385898-182385920 CTCTGATGCCCGGCCGAAGCTGG + Intronic
943100184 2:183478588-183478610 CTCTGATGCCGAGTGGAGGCTGG + Intergenic
943297348 2:186154956-186154978 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
943323285 2:186472287-186472309 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
943577902 2:189652990-189653012 CTCTGATGCCCAGCGGAGGCTGG + Intergenic
943648484 2:190431662-190431684 CCCTGATGCTGAGCCGAAGCTGG - Intronic
943740181 2:191399223-191399245 CTCTGATGCCGAGCCAAAGCTGG - Intronic
943863060 2:192893519-192893541 CTCTGATGCTGAGCCGAGGCTGG + Intergenic
944060542 2:195567232-195567254 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
944229725 2:197380595-197380617 CTGGGAGGCCGAGCCGAGGCAGG - Intergenic
944255169 2:197618124-197618146 CTCTGATGCCCAGCCGAAGCTGG + Intronic
944263308 2:197697369-197697391 CTCTCATGCCGAGCCGAAGCTGG - Intronic
944283721 2:197924104-197924126 CTCTCATGCGGAGCCGAAGCTGG - Intronic
944533209 2:200684689-200684711 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
944570695 2:201041995-201042017 CTCTGATGCCGAGCCGAGGCTGG + Intronic
944585277 2:201166920-201166942 CTCTGATGCCGAGCCGAAGCTGG - Exonic
944599036 2:201284634-201284656 CTCTCATGCCGAGCCAAAGCTGG - Intronic
944722796 2:202440754-202440776 CTCTGATGCCAAGCCAAGGCTGG - Intronic
944733224 2:202536031-202536053 CTCTCATGCCGAGCCGAAGCTGG - Intronic
944751739 2:202716039-202716061 CTCTGATGCCGAGCCAAAGCTGG - Intronic
944797791 2:203206454-203206476 CTCTGATGCCGAGCCAAAGCTGG + Intronic
944815739 2:203373420-203373442 CTCTGATGCCGAGCAGAAGCTGG - Intronic
945232787 2:207609836-207609858 CTCTGATGCCGAGCCAAGGCTGG + Exonic
945234057 2:207618144-207618166 ATTTGATGCCCAGCCAAGGCTGG - Intronic
945316814 2:208378330-208378352 CTCTGATGCCGAGCCAAAGCTGG - Intronic
945530658 2:210950179-210950201 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
945835978 2:214836312-214836334 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
945864990 2:215164230-215164252 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
945970603 2:216227513-216227535 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
946100511 2:217316274-217316296 CTCTGATCCCCTGCTGAGACAGG - Intronic
946304031 2:218845949-218845971 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
946317977 2:218930837-218930859 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
946447504 2:219751956-219751978 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
946650803 2:221891560-221891582 CTCTGATGCCAAGCCGAAGCTGG + Intergenic
946742442 2:222815730-222815752 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
946751628 2:222897879-222897901 CTCTGATGCCGAGCCGAAGCTGG - Intronic
947402187 2:229742217-229742239 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
947596558 2:231415798-231415820 CTCTGTTGTCCAGGCCAGGCTGG - Intergenic
947797644 2:232905140-232905162 CTCTCATGCCGAGCCAAAGCTGG + Intronic
947901556 2:233725144-233725166 CTCTCATGCAGAGCCGAAGCTGG - Intronic
948000293 2:234562204-234562226 CCCTGATGCCGAGCCGAAGCTGG + Intergenic
948651813 2:239450335-239450357 CTCTGATGCCAAGCCGAAGCTGG - Intergenic
1169085502 20:2823104-2823126 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1169109016 20:3020031-3020053 CTCCGATGCCGAGCCGAAGCTGG - Intronic
1169246730 20:4031887-4031909 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1169370669 20:5026934-5026956 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1169441922 20:5639958-5639980 CTCTGATGCCGAGCCGAAGGTGG - Intergenic
1169449725 20:5701390-5701412 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
1169706732 20:8514408-8514430 CTCTGTTGCCCAGCGCAGGCTGG - Intronic
1169718124 20:8643833-8643855 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1169885783 20:10395736-10395758 CTCTGATGCCGAGCCGAACCTGG - Intergenic
1169992060 20:11514147-11514169 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1170470184 20:16661012-16661034 CTCTGTTGCCCAGGCTGGGCAGG + Intergenic
1170592057 20:17778615-17778637 CTCTGATGCCGAGCCCAAGCTGG + Intergenic
1170599621 20:17831343-17831365 CTCTGATTCCCGGGTGAGGCCGG - Intergenic
1170645551 20:18193944-18193966 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
1170664688 20:18376251-18376273 CTCTGATGCCGAGCGGAAGCTGG - Intergenic
1170811783 20:19679460-19679482 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1171366294 20:24627033-24627055 CTCTCATGCCGAGCCGAAGCTGG - Intronic
1171463515 20:25312217-25312239 CTCTGATGCCAAGCCGAAGCTGG + Intronic
1171496665 20:25561075-25561097 CTCTCATGCCGAGCCGAAGCTGG + Intronic
1171848639 20:30292609-30292631 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1171861082 20:30404256-30404278 CTCTGATGCCAGGCCGAAGCTGG + Intergenic
1171900045 20:30847895-30847917 CTCTGATGCCGAGCGGAAGCTGG - Intergenic
1171951470 20:31426338-31426360 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1171957659 20:31472360-31472382 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1172051786 20:32123126-32123148 CTCTCATGCCGAGCCGAAGCTGG - Intronic
1172058890 20:32175381-32175403 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1172141012 20:32723183-32723205 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1172199456 20:33115001-33115023 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1172209376 20:33186152-33186174 CTCTGATGCCCAGCCGAAGCTGG - Intergenic
1172237561 20:33388663-33388685 CTCTGATGCCCAGCCAAAGCTGG + Intronic
1172249910 20:33471870-33471892 CTCTGTTACCCAGGCCAGGCTGG + Intergenic
1172258270 20:33537444-33537466 CTCTGATGCCCAGCCGAAGCTGG - Intronic
1172279143 20:33698527-33698549 CTCTGATGCCGAGCGGAAGCTGG + Intergenic
1172279788 20:33700815-33700837 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
1172337743 20:34131883-34131905 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1172379407 20:34475612-34475634 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1172401791 20:34658031-34658053 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1172465386 20:35152912-35152934 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1172501135 20:35428352-35428374 CTCTGTTTCCCAGCCCAGGCTGG + Intergenic
1172575207 20:36002354-36002376 CTCTGCTGCCCAGCCGAAGCTGG - Intronic
1172717911 20:36977612-36977634 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1172720815 20:36999530-36999552 CCCTGATGCCGAGCCAAAGCTGG + Intronic
1172722626 20:37011914-37011936 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1172728726 20:37068887-37068909 CTCTCATGCTGAGCCGAAGCTGG + Intronic
1172735663 20:37125258-37125280 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1172907079 20:38378207-38378229 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1172918732 20:38462498-38462520 CTCTGATGCCAAGCCGAAGCTGG - Intergenic
1172976890 20:38912897-38912919 CTCTGTTGCCCAGGCTAGACTGG + Intronic
1173273328 20:41556209-41556231 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1173508599 20:43608104-43608126 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1173559233 20:43990673-43990695 CTTGGATGCCAAGCAGAGGCCGG + Intronic
1173669630 20:44789753-44789775 CTATGTTGCCCAGCCTGGGCTGG + Intronic
1173769751 20:45646735-45646757 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1174020809 20:47526718-47526740 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1174186093 20:48707302-48707324 CCTTCCTGCCCAGCCGAGGCTGG - Intronic
1174344700 20:49921488-49921510 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1174400734 20:50274509-50274531 CTCTGTTGCCCAGCCTGGTCTGG - Intergenic
1174835679 20:53853854-53853876 CCCTGATGCCGAGCCAAAGCTGG + Intergenic
1175212915 20:57372778-57372800 CTCAGATGACCAGCTTAGGCAGG + Intronic
1175442406 20:59001205-59001227 TTCTGATCCCCAGCCCAAGCGGG + Intronic
1175475450 20:59270210-59270232 CTCCGATGTCCAGCACAGGCTGG - Intergenic
1175776073 20:61654382-61654404 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1176069115 20:63216817-63216839 CTCTGTGCCCCAGCCTAGGCCGG + Intergenic
1176348589 21:5771758-5771780 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1176355403 21:5892342-5892364 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1176496238 21:7552697-7552719 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1176542910 21:8169828-8169850 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1176561861 21:8352873-8352895 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1176656837 21:9594481-9594503 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1177134355 21:17293040-17293062 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1177788449 21:25696345-25696367 CTCTGATGCCGAGCGGAAGCTGG - Intronic
1178034232 21:28563248-28563270 CTCTGATGCTGAGCCAAAGCTGG + Intergenic
1178075356 21:29010706-29010728 CTCTGATTCCGAGCCGAAGCTGG + Intronic
1178422137 21:32451437-32451459 CTCTGAGGCCCAGCAGGCGCAGG - Intronic
1178587058 21:33879465-33879487 GGCTGAGGCCCAGCCGAGGAAGG + Intronic
1178638967 21:34330545-34330567 CTCTGCTGCTCAGCAGAGCCTGG + Intergenic
1178839906 21:36130156-36130178 CGCTGCTGCCCAGCCGGGGCTGG - Intergenic
1178873273 21:36393169-36393191 CTCTGATGCCAAGCCGAGGCTGG - Intronic
1179332348 21:40416102-40416124 CCCTCATGTCCAGCCAAGGCAGG - Intronic
1179803189 21:43821625-43821647 GTCTGATGCTGAGCCCAGGCTGG + Intergenic
1179969006 21:44824120-44824142 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1179995544 21:44972388-44972410 CTCTGACGTCCACCCCAGGCAGG - Intronic
1180124933 21:45784499-45784521 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1180671957 22:17560668-17560690 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1180739432 22:18042315-18042337 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1180861131 22:19083757-19083779 CTCTGATGCCGAGCTGAAGCTGG + Intronic
1180907635 22:19425979-19426001 CTCTGTTACCCAGGCCAGGCTGG - Intronic
1181011970 22:20046434-20046456 CCATGGTGCCCAGCCAAGGCTGG + Intronic
1181016071 22:20069676-20069698 CTCTGATGCCCAGGCCAGGCAGG + Intergenic
1181274096 22:21677654-21677676 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1181301691 22:21884738-21884760 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1181585950 22:23853853-23853875 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
1181598735 22:23936479-23936501 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
1181617709 22:24065961-24065983 CTCTGATGCCAAGCCGAAGCTGG - Intronic
1181658177 22:24318478-24318500 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1181697742 22:24602322-24602344 CTCTCATGCCCAGCCAGGTCAGG + Intronic
1181792472 22:25278579-25278601 CTCTGATGCCCAGCCGAAGCTGG - Intergenic
1182199211 22:28552825-28552847 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1182330978 22:29551824-29551846 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1182343791 22:29644878-29644900 CTCTCATGCCGAGCCAAAGCTGG - Intronic
1182377554 22:29858924-29858946 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1182399676 22:30066136-30066158 CTCTGATGCCAAGCCGAAGCTGG + Intergenic
1182484706 22:30632448-30632470 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1182538726 22:31026328-31026350 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1182564166 22:31184872-31184894 CTCTGATGCCGAGCTGAGGCTGG - Intronic
1182617003 22:31593942-31593964 CTCTCATGCGGAGCCGAAGCTGG - Intronic
1182648461 22:31829782-31829804 CCCTGCTGCCCAGCAGAGACAGG + Intronic
1182976464 22:34626934-34626956 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1182982594 22:34685232-34685254 CTCTGATGCCTAGCCGAAGCTGG - Intergenic
1183434596 22:37786265-37786287 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1183509887 22:38228491-38228513 TTCTGATGTCCAGCCCAGCCTGG - Intronic
1183544047 22:38446311-38446333 CTCTGCTGCCCAGCCACTGCCGG + Intronic
1183871886 22:40746352-40746374 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1183940784 22:41294090-41294112 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1183995897 22:41632085-41632107 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1184145339 22:42607150-42607172 CTCTGATGCCGAGCCGAGGCTGG + Intronic
1184169603 22:42751204-42751226 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1184201202 22:42971124-42971146 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1184202458 22:42980525-42980547 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1184280539 22:43435094-43435116 CTCTGATACCCACTCGAGGACGG + Exonic
1184533450 22:45071160-45071182 CCCTGATGCCCAGGCCAGGTCGG + Intergenic
1185287892 22:50010656-50010678 CTCTGAAGCCCACCCAGGGCTGG + Intronic
1203247777 22_KI270733v1_random:86071-86093 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
949551307 3:5114612-5114634 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
949565791 3:5243437-5243459 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
949570149 3:5284681-5284703 CTCTGATACCGAGCCGAAGCTGG - Intergenic
949853173 3:8439090-8439112 CTCTGATACCGAGCCGAAGCTGG + Intergenic
949936449 3:9119749-9119771 GTCTGATGCCCGGCTGAAGCAGG + Intronic
949988602 3:9559435-9559457 CTCTCATGCTGAGCCGAAGCTGG + Intergenic
949989764 3:9569519-9569541 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
949992506 3:9591336-9591358 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
950044409 3:9940625-9940647 CTCTGATGCCAAGCTGAAGCTGG - Intronic
950060667 3:10069500-10069522 CTCTGATGCCGAGCCAAAGCTGG + Intronic
950412877 3:12850479-12850501 CTCTGATGCCGAGCCACAGCTGG - Intronic
950742238 3:15061254-15061276 CTCTGATGCCGAGCCGAAGCTGG + Intronic
950755067 3:15164098-15164120 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
950949322 3:16981093-16981115 CTCTGATGCCGAGCCGAAGCTGG - Intronic
951290640 3:20867747-20867769 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
951550686 3:23872330-23872352 CTCTGATGCCGAGCCGAAGCTGG - Intronic
952308725 3:32169129-32169151 CTCTGATGCTGAGCCGAAGCTGG + Intergenic
952364550 3:32663513-32663535 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
952894144 3:38065295-38065317 CTCTGATGCCGAGCGGAGGCTGG - Intronic
952933157 3:38375377-38375399 CTCAGTTGCCCAGCAGAGCCCGG - Intronic
953084285 3:39651934-39651956 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
953111747 3:39947736-39947758 CTCTGTTGCCCAGGCCAGGCTGG - Intronic
953176430 3:40557641-40557663 CAATGTTGCCCAGGCGAGGCAGG + Intronic
953257425 3:41305269-41305291 CTCTCATGCTGAGCCGAAGCTGG + Intronic
953425840 3:42796997-42797019 CTCTCATGCGGAGCCGAAGCTGG + Intronic
953440283 3:42910309-42910331 CTCTAAAGCCCAGCCAAGGCTGG - Intronic
953854950 3:46493951-46493973 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
953922662 3:46963494-46963516 CTCTGATGCCCAGCCGAAGCTGG + Intronic
953959364 3:47255798-47255820 CTCTGATGCCGAGCCGAAGCTGG + Intronic
953966343 3:47309947-47309969 CTCTGATGCCGAGCCGAAGCTGG - Intronic
954048195 3:47951388-47951410 CTCTGATGCCGAGCCGAAGCTGG + Intronic
954059132 3:48055253-48055275 CTCTCATGCGGAGCCGAAGCTGG + Intronic
954060237 3:48061231-48061253 CTCTGATGCCGAGCCGAAGCTGG + Intronic
954162578 3:48733545-48733567 CTCTGATGCCAAGCCAAAGCTGG + Intronic
954191061 3:48961503-48961525 CTATTATGCCAAGCCCAGGCTGG - Intronic
954356426 3:50085805-50085827 CTCTGATGCCGAGCCGAAGCTGG - Intronic
954399781 3:50312933-50312955 CTCTGATGCCGAGCGGAAGCTGG - Intergenic
954481503 3:50804696-50804718 CTCTGATGCCAAGCGGAGGCTGG - Intronic
954529934 3:51309541-51309563 CTCTGATGCCGAGCCGAAGCTGG - Intronic
954567222 3:51608783-51608805 CTCTGATGCCGAGCCGAGGCTGG - Intronic
954567230 3:51608817-51608839 CTCTGATGCCAAGCCAAGGCTGG - Intronic
954599629 3:51858029-51858051 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
954752733 3:52822891-52822913 CCCTGATCCCCAGGCCAGGCTGG + Intronic
955173195 3:56585049-56585071 CTCTGATGCCGAGCCGAAGCTGG - Intronic
955363262 3:58291335-58291357 CTCTGATGCCGAGCCGAAGCTGG - Intronic
955395073 3:58551078-58551100 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
955435094 3:58891371-58891393 CTCTCATGCGGAGCCGAAGCTGG - Intronic
955670216 3:61394343-61394365 CTCTGATGCGGAGCCGAGGCTGG - Intergenic
955674716 3:61435675-61435697 CTCTCATGCTGAGCCGAGGCTGG - Intergenic
955699965 3:61672676-61672698 CTCTGATGCCGAGCCGAAGCTGG - Intronic
956704059 3:71984106-71984128 CTGTGATGCCCAGAGGAGACTGG + Intergenic
956803704 3:72787753-72787775 CTCTGATGCCGAGCGGAGGCTGG + Intronic
957035292 3:75288747-75288769 CTCTGATGCCTAGCCAAAGCTGG + Intergenic
957316957 3:78584266-78584288 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
957619975 3:82583907-82583929 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
958809080 3:98838993-98839015 CTCTCATGCGGAGCCGAAGCTGG - Intronic
958957651 3:100478933-100478955 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
959201865 3:103255858-103255880 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
959415915 3:106075746-106075768 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
959586188 3:108026842-108026864 CACTGATGCCGAGCCGAAGCTGG - Intergenic
959683619 3:109123411-109123433 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
960030271 3:113047498-113047520 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
960073492 3:113458251-113458273 CTCTGATGCCCAGCCGAGGCTGG + Intronic
960210290 3:114956508-114956530 CTATGATTCCCAGCTGAGGGAGG - Intronic
960344743 3:116518672-116518694 CTCTGATGCCCAGCCTAGGCTGG + Intronic
960388490 3:117050084-117050106 CTCTGATGCAGAGCCAAAGCTGG + Intronic
960577344 3:119242004-119242026 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
960770925 3:121191496-121191518 CTCTGATGCCCAGCCGAGGCTGG - Intronic
960780792 3:121314552-121314574 CTCTGATGCCGAGCCAAAGCTGG - Intronic
960817397 3:121688224-121688246 CTCTGATGCCGAGCCAAAGCTGG + Intronic
960866229 3:122202375-122202397 CTCTGATGCTGAGCCGAAGCTGG - Intronic
960920837 3:122746691-122746713 CTCTGATGCCGAGCCGAAGCTGG + Intronic
960924584 3:122781512-122781534 CTCTGGTGCCAAGCCGAAGCTGG - Intronic
961120925 3:124369007-124369029 CTCTCATGCGGAGCCGAAGCTGG - Intronic
961164056 3:124751305-124751327 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
961408358 3:126699343-126699365 CTATGTTGCCCAGCCCAGGCTGG - Intergenic
961729042 3:128953654-128953676 CTCTCATGCGGAGCCGAAGCTGG + Intronic
961784661 3:129340755-129340777 CTCTGATGCCGAGCAGAAGCTGG - Intergenic
961789278 3:129364296-129364318 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
961962254 3:130867348-130867370 CTCTGATGCCGAGCCAAAGCTGG + Intronic
962063035 3:131951601-131951623 CTCTGATGCCGAGCAGAAGCTGG + Intronic
962113232 3:132472193-132472215 CTCTCATGCGGAGCCGAAGCTGG - Intronic
962269078 3:133964918-133964940 CTCTGATGATGAGCCGAGCCAGG - Intronic
962572015 3:136722730-136722752 CACTGATGCCGAGCCGAAGCTGG + Intronic
962623217 3:137199237-137199259 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
962652985 3:137514914-137514936 CACTGAAGCCCAGAGGAGGCAGG + Intergenic
962787797 3:138784468-138784490 CTCTGATGCCGAGCGGAGGCTGG + Intronic
963249249 3:143087545-143087567 CTCTGATGCCCAGCCAAGGCTGG - Intergenic
963498222 3:146095925-146095947 CTCTGATGCCGAGCCAAAGCTGG + Intronic
963776535 3:149445701-149445723 CTCTGATGCCAAGATGAAGCTGG - Intergenic
963911777 3:150821794-150821816 CTCTGATGCCGAGCCAAGGCTGG - Intergenic
965302191 3:167018143-167018165 CTCTGATGCCAAGCCAAGGCTGG + Intergenic
965612308 3:170557318-170557340 TTCTGCTGCCCAGCCGAGCCTGG + Intronic
965619832 3:170632271-170632293 CTCTGTCGCCCAGGCCAGGCTGG + Intronic
966015687 3:175133679-175133701 CTCTGATGCCAAGCCGAAGCTGG - Intronic
966201072 3:177359881-177359903 CGCTGCCGCCCAGCCCAGGCGGG - Intergenic
966206829 3:177413613-177413635 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
966253612 3:177892536-177892558 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
966292335 3:178374488-178374510 CTCAGAAGCCAAGCCGATGCTGG + Intergenic
966350850 3:179032042-179032064 CTCTGATGCTGATCCGAGGCTGG + Intronic
966375521 3:179291654-179291676 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
966420359 3:179728912-179728934 CTCTGATGCCGAGCTGAAGCTGG - Intronic
966617361 3:181926626-181926648 CTCTGATGCCCAGCCGAGGCTGG - Intergenic
966783690 3:183607377-183607399 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
966967085 3:185004437-185004459 CTCTGAGGCCGAGCCGAGGCTGG - Intronic
967127393 3:186436158-186436180 CTCTGATGCCCAGCAGAGGCTGG - Intergenic
967169538 3:186812388-186812410 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
967175935 3:186863578-186863600 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
967178825 3:186885509-186885531 CTCTGATGCCTAGCTGAGGCTGG - Intergenic
967487272 3:190047750-190047772 CTCTGATGGCTACCAGAGGCTGG + Intronic
967524111 3:190472740-190472762 CCCTGATGCCGAGCCAAAGCTGG + Intergenic
967578666 3:191125740-191125762 CTCTGATGCCCAGCGGAGGCTGG - Intergenic
968042570 3:195600422-195600444 CTCTAATGCCAAGCCGAAGCTGG - Intergenic
968139296 3:196243572-196243594 CTCTGATGCCGAGCGGAAGCTGG + Intronic
968156403 3:196385041-196385063 CTCTGATGCTGAGCCGAGGCTGG + Intronic
968201988 3:196762643-196762665 CTCTCATGCGGAGCCGAAGCTGG - Intronic
968226087 3:196973263-196973285 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
968299696 3:197603151-197603173 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
968411495 4:395028-395050 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
968430017 4:551369-551391 CTCTCATGCCGAGCCGAGGCTGG - Intergenic
968506995 4:975381-975403 CTCTGATGCCGAGCCAAAGCTGG + Intronic
968852962 4:3095483-3095505 CTCTGATGCCGAGCCAAGGCTGG - Intronic
969042135 4:4307351-4307373 CTCTGAACCCCAGGCCAGGCTGG - Intronic
969384913 4:6837871-6837893 CTCTAATGCCCAGCCAAGGCTGG - Intronic
969404012 4:6977159-6977181 CCCTGATGCCGAGCCAAAGCTGG + Intronic
969719840 4:8887561-8887583 CTCTGAGGGGCAGCCCAGGCAGG + Intergenic
970216254 4:13762042-13762064 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
970409076 4:15790221-15790243 CTCTGATGCCGAGCCAAAGCTGG + Intronic
970472898 4:16394258-16394280 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
971282212 4:25250176-25250198 CTCTGATGCGGAGCCGAGGTTGG - Intronic
971595000 4:28515735-28515757 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
971773568 4:30930729-30930751 CTCTGTTGCCCAGGCGAGTCTGG - Intronic
972270867 4:37509920-37509942 CTCTGATGCCCAGCCGAAGCTGG - Intronic
972288121 4:37668254-37668276 CTCTGATACCGAGCCGAAGCTGG + Intronic
972304585 4:37819869-37819891 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
972412261 4:38806879-38806901 CTCTGATGCCGAGCCGAAGCTGG + Intronic
972490261 4:39580554-39580576 CTCTGTCACCCAGGCGAGGCTGG + Intronic
972551939 4:40142045-40142067 CTCTGATACCGAGCCGAAGCTGG - Intronic
972552793 4:40148408-40148430 CTCTGATGCCGAGCCGAAGCTGG - Intronic
972653995 4:41048711-41048733 CTCTGATGCCGAGCGGAAGCTGG + Intronic
972938322 4:44167381-44167403 CTCTGATGCCGAGCGGAGGCTGG + Intergenic
972939588 4:44181284-44181306 CTCTGATGCCGAGCCGAGGCTGG + Intronic
973108945 4:46376808-46376830 CTCTGATGCCGAGCTGAAGCTGG + Intronic
973274232 4:48291806-48291828 CTCTGATGCCGAGCCGAAACTGG + Intergenic
973281672 4:48364822-48364844 CTCTCATGCGGAGCCGAAGCTGG - Intronic
973593256 4:52464153-52464175 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
973650286 4:52992065-52992087 CTCTGATGCCGAGCCGAAGCTGG + Intronic
973663967 4:53138909-53138931 CTCTGATGCCCAGCCGAGGCTGG + Intronic
973675381 4:53256822-53256844 CTCTGATGCCTAGCCGAAGCTGG - Intronic
973752181 4:54032304-54032326 CTCTGATGCCGAGCCGAAGCTGG + Intronic
973785217 4:54326468-54326490 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
973891404 4:55370851-55370873 CTCTGTTGCCCAGGCCAGGCTGG - Exonic
974021371 4:56694245-56694267 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
974082025 4:57223839-57223861 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
974601064 4:64080167-64080189 CTCTGATGTCCAGCCCATGAAGG + Intergenic
974870408 4:67636430-67636452 CTCTGATGCCGAGCCGAAGCTGG + Intronic
974977108 4:68905292-68905314 ATTTGAGGGCCAGCCGAGGCTGG - Intergenic
975042303 4:69761399-69761421 CTCTGATGCCGAGCCGAAGCTGG + Intronic
975063668 4:70036992-70037014 CTCTGATGCCGAGCAGAGGCTGG + Intergenic
975633303 4:76422776-76422798 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
975685423 4:76916118-76916140 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
975793853 4:77984721-77984743 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
975848218 4:78547377-78547399 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
976132617 4:81900862-81900884 CTCTGATACACAGCCGAAGGAGG - Intronic
976149270 4:82077154-82077176 CTCTGATGCCGAGCAGAGGCTGG + Intergenic
976264918 4:83181515-83181537 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
976266152 4:83186952-83186974 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
976341024 4:83944619-83944641 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
976607257 4:86995350-86995372 CTCTGATGCCGAGCCGAAGCTGG + Intronic
977204963 4:94157323-94157345 CTCTCATGCTGAGCCGAAGCTGG + Intergenic
978014129 4:103722741-103722763 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
978224762 4:106320785-106320807 CTCTGATGCCGAGCCGAGGCTGG + Intronic
978373439 4:108051595-108051617 CTTTGAAGCCCAGCCGCAGCCGG - Intronic
978408971 4:108408858-108408880 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
978519208 4:109598553-109598575 CTCTCATGCCCAGCCGAAGCTGG - Intronic
978820418 4:112958551-112958573 CTCTGATGCCGAGCCGAAGCTGG - Intronic
978947374 4:114515940-114515962 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
979250402 4:118561245-118561267 CTGTATTGCCCAGCCCAGGCTGG - Intergenic
979273579 4:118791563-118791585 CTCTGATGCCGAGCCGAGACTGG + Intronic
979622216 4:122811230-122811252 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
979641790 4:123017079-123017101 CACTGATGCCGAGCCGAAGCTGG - Intronic
979941619 4:126770644-126770666 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
980056682 4:128084582-128084604 CTCTGATGCCGAGCCGAAGCTGG - Intronic
980883540 4:138738834-138738856 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
980895000 4:138853506-138853528 CTCTCATGCCGAGCAGAAGCTGG + Intergenic
981677316 4:147357314-147357336 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
981993535 4:150953403-150953425 CTCTGATGCCGAGCCAAGGCTGG + Intronic
981994682 4:150963224-150963246 CTCTGATGCCGAGCCGAGGCTGG + Intronic
982040251 4:151390208-151390230 CTCTGATGCTGAGCCAAAGCTGG + Intergenic
982053789 4:151527481-151527503 CTCTGATGCCGAGCCGAAGCTGG - Intronic
982075156 4:151731153-151731175 CTCTGATGCCAAGCCGAGGCTGG + Intronic
982183027 4:152766077-152766099 CTCTGATGCCCAGCCGAGGCTGG - Intronic
982192215 4:152867453-152867475 CTCTGATGCCGAGCAGAAGCTGG - Intronic
982288986 4:153760876-153760898 TTCTGATGCCCAGTTAAGGCTGG - Intergenic
982709869 4:158747434-158747456 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
982723332 4:158881489-158881511 CTCTGATGCTGAGCCGAAGCTGG + Intronic
982989176 4:162249192-162249214 CTCTGTTGCCCAGGCTGGGCTGG + Intergenic
983218302 4:165020905-165020927 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
983604402 4:169569530-169569552 CTCTGATGCCGAGCCGAAGCTGG + Intronic
983652079 4:170045792-170045814 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
983664612 4:170167037-170167059 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
983906183 4:173184555-173184577 CTCTGATGCCGAGCCGAGGCTGG - Intronic
984037727 4:174691428-174691450 CTCTGATGCCCAGCCAAAGCTGG + Intronic
984728293 4:183041607-183041629 CTCTGATGCCCAGCCGAAGCTGG - Intergenic
984804399 4:183737746-183737768 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
984813871 4:183819502-183819524 CTCTGATGCCCAGCCGAAGCAGG - Intergenic
984836916 4:184030946-184030968 CTCTGCTGCCCAGGCTGGGCTGG + Intergenic
985216243 4:187657531-187657553 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
985247376 4:187991903-187991925 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
985705248 5:1396695-1396717 CTCTGATGCCCACACAGGGCTGG + Intronic
985736274 5:1585448-1585470 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
987469134 5:18309022-18309044 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
988544173 5:32141640-32141662 CTCTGATGCCGAGCCAAAGCTGG + Intronic
988760840 5:34307656-34307678 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
989021665 5:37014164-37014186 CTCTGATGCCGAGCCGAAGCTGG - Intronic
989048292 5:37295088-37295110 CTCTGATGCCGAGCCGAAGCTGG + Intronic
989061747 5:37416466-37416488 CTCTGATGCCGAGCCGAAGCTGG - Intronic
989068311 5:37484512-37484534 CTCTGATGCCAAGCCGAAGCTGG - Intronic
989211718 5:38863121-38863143 CTCTGATGCCGAGCCGAAGCTGG - Intronic
989574598 5:42978735-42978757 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
989574883 5:42979871-42979893 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
989588160 5:43089076-43089098 CTCTGATGCCGAGCCGAAGCTGG - Intronic
989633333 5:43510479-43510501 CTCTGATGCCTAGCGGAAGCTGG + Intronic
989634699 5:43521539-43521561 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
989648924 5:43666549-43666571 CCCTGATGCCGAGCTGAGGCTGG - Intronic
989656085 5:43747046-43747068 CTCTGATGCTGAGCCAAGGCTGG - Intergenic
989663619 5:43825321-43825343 CTCTGATGCCCAGCCGAGGCTGG - Intergenic
989828727 5:45890014-45890036 CTCTGATGCCAAGCCAGAGCTGG + Intergenic
990293748 5:54380819-54380841 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
990297903 5:54421321-54421343 CTCTGATGCCCAGCGGAAGCTGG - Intergenic
990459256 5:56015930-56015952 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
990462175 5:56039525-56039547 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
990485884 5:56258809-56258831 CTCTGATGCCAAGCGGAGGCTGG - Intergenic
990498446 5:56371972-56371994 CTCTGATGCTGAGCCGAGGCTGG + Intergenic
990825527 5:59893721-59893743 TTCTGCAGCCCAGCAGAGGCTGG + Exonic
990871182 5:60432029-60432051 CTCTGATGCCGAGCTGAAGCTGG - Intronic
990950061 5:61289751-61289773 CACTGATGCCCACCCCGGGCAGG - Intergenic
991127521 5:63084584-63084606 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
991373082 5:65939585-65939607 CACTGATGCCGAGCCGAAGCTGG + Intronic
991375244 5:65958578-65958600 CTCTGATGCCCAGCCGAAGCTGG - Intronic
991523325 5:67526267-67526289 CTCTGCTACCCAGGCCAGGCTGG - Intergenic
991598048 5:68324510-68324532 CTCTGATGCCCAGCTGAAGCTGG - Intergenic
991672754 5:69063654-69063676 CTCTGATGCGGAGCCGAAGCTGG - Intergenic
991672772 5:69063739-69063761 GTCTGATGCCGAGCCGAAGCTGG - Intergenic
991723824 5:69516454-69516476 CACTGATGCCGAGCCGAAGCTGG - Intronic
991910271 5:71552777-71552799 CTCTGATGCCGAGCCGAAGCTGG - Intronic
992012769 5:72545830-72545852 CTCTGATGCCAAAACCAGGCAGG - Intergenic
992054552 5:72975532-72975554 CTCTGTTACCCAGCCCAGGCTGG + Intronic
992289450 5:75269578-75269600 CTCTGATGCCAAGCCGAAGCTGG + Intergenic
992415965 5:76551811-76551833 CTCTGATGCCCAGCGGAGGCTGG - Intronic
992442820 5:76811643-76811665 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
992463961 5:76985851-76985873 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
992574303 5:78096049-78096071 CTCTGATGCCGAGCTGAAGCTGG + Intronic
992600333 5:78391964-78391986 CTCTGATGCCAAGCCGAAGCTGG - Intronic
992801597 5:80300609-80300631 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
992964361 5:81984384-81984406 CTCTGATGCTGAGCCGAAGCTGG - Intronic
992977847 5:82138891-82138913 CTCTCATGCGGAGCCGAAGCTGG + Intronic
993496464 5:88615295-88615317 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
993658045 5:90596747-90596769 CTCTGATGCCGAGCGGAAGCTGG - Intronic
994907359 5:105858957-105858979 CTCTCATGCTGAGCCGAAGCTGG + Intergenic
995123770 5:108560087-108560109 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
995162006 5:108993496-108993518 CTCTGATGCCGAGCCGAAGCTGG - Intronic
995236387 5:109833627-109833649 CTCTGATGCCGAGCAGAGGCCGG - Intronic
995456701 5:112360312-112360334 CTCTGATGCTGAGCCCAGGCTGG + Intronic
995515810 5:112954248-112954270 CTCTCATGCCGAGCCGAAGCCGG + Intergenic
995709933 5:115025079-115025101 CTCTCATGCTCAACCCAGGCAGG - Intergenic
995895129 5:117002850-117002872 CACTGATGCCAAGCCGAAGCTGG - Intergenic
995942514 5:117600741-117600763 CACTGATGCCGAGCCGAAGCTGG - Intergenic
995994330 5:118282059-118282081 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
996033980 5:118737802-118737824 CTCTGTCGCCCAGGCCAGGCTGG + Intergenic
996053971 5:118964478-118964500 CTCTGATGCCGAGCCGAAGCTGG + Intronic
996057572 5:118998530-118998552 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
996070225 5:119123260-119123282 CTCTGATGCCGAGCCGAAGCTGG - Intronic
996159741 5:120147460-120147482 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
996386436 5:122914067-122914089 CTCTGATGCCAAGCCAAAGCTGG - Intronic
997139694 5:131365258-131365280 CTCTGTGGCCCAGTCCAGGCTGG - Intronic
997321793 5:132983888-132983910 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
997468784 5:134105077-134105099 CCCTGGTACCCAGCAGAGGCTGG + Intergenic
997565458 5:134882797-134882819 CTCTGATGCCGAGCCGAAGCTGG - Intronic
997636158 5:135408616-135408638 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
997875128 5:137539036-137539058 CTCTGATGCCGAGCCGAAACTGG - Intronic
997923186 5:138002497-138002519 CTCTGTTGCCCAGGCTGGGCTGG - Intronic
998022023 5:138777815-138777837 CACTGATGCCGAGCTGAAGCTGG - Intronic
998025456 5:138811876-138811898 CTCTGATGCCGAGCTGAAGCTGG - Intronic
998053479 5:139055709-139055731 CTCTGATGCCTAGCCGAAGCTGG + Intronic
998059923 5:139111883-139111905 CTCTGATGCCGAGCCAAAGCTGG + Intronic
998067283 5:139169905-139169927 CTCTGATGCCGAGCCGAAGCTGG + Intronic
998074302 5:139223916-139223938 CTCTGATGCTGAGCCGAAGCTGG + Intronic
998239644 5:140428593-140428615 CTCTGATGCCGAGCCAAAGCTGG - Intronic
998409790 5:141900922-141900944 TTAAGATGCCCAGCAGAGGCCGG - Intergenic
998432362 5:142077289-142077311 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
999158852 5:149478305-149478327 CTCTGTCACCCAGCCCAGGCAGG + Intergenic
999181289 5:149671353-149671375 CCCTGATGCCGAGCCAAAGCTGG - Intergenic
999455804 5:151714803-151714825 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
999532808 5:152480767-152480789 CTCTGATGCCGAGCGGAAGTTGG - Intergenic
999604338 5:153297737-153297759 CTCTCATGCCAAGCTGAAGCTGG - Intergenic
999986852 5:157013581-157013603 CTCTGATGCCAAGCCGAAGCTGG + Intergenic
1000032784 5:157418987-157419009 CTCTGATGCCAAGCCAAAGCTGG + Intronic
1000158995 5:158581836-158581858 CACTGATGCCCAGCCGAAGCTGG + Intergenic
1001078070 5:168644375-168644397 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1001691274 5:173634241-173634263 CCATGTTGCCCAGCCCAGGCTGG - Intergenic
1002008185 5:176253096-176253118 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1002013479 5:176304236-176304258 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1002031382 5:176433113-176433135 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1002031391 5:176433160-176433182 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1002073738 5:176696063-176696085 GTCTGTTCCCCAGCAGAGGCAGG + Intergenic
1002115595 5:176960680-176960702 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1002489578 5:179565206-179565228 CTCTATCGCCCAGCCCAGGCTGG + Intronic
1002529538 5:179835643-179835665 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1002658390 5:180771739-180771761 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
1002697481 5:181100644-181100666 CGCTGCTGCCCGGCGGAGGCGGG + Intergenic
1002772446 6:301372-301394 TTCTTATGTCCAGCCGAGCCAGG - Intronic
1003319624 6:5038834-5038856 CTCTGATGCCGAGCCAAGGCTGG - Intergenic
1003407595 6:5836605-5836627 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1003712549 6:8608904-8608926 CTGAGCTGCCCAGCCCAGGCAGG + Intergenic
1003852700 6:10241450-10241472 CTTTGATGCCCAGCTGGGGTTGG - Intergenic
1004152328 6:13133332-13133354 CTCTGATGCCAAACGGAGGCCGG + Intronic
1004409745 6:15369942-15369964 CTCTGATTCTCAGCAGAGGCTGG - Intronic
1004415151 6:15416645-15416667 CACTGATGCCAAGCCGAAGCTGG - Intronic
1004448984 6:15727274-15727296 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1004664413 6:17736435-17736457 CACTGACGCCGAGCCGAAGCTGG - Intergenic
1004780045 6:18898173-18898195 CTGTAATCCCCAGCCAAGGCGGG - Intergenic
1004874191 6:19938738-19938760 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1005063754 6:21798328-21798350 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1005158587 6:22835773-22835795 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1005321905 6:24663735-24663757 TCCTGAGGCCCAGCAGAGGCTGG + Intronic
1005414636 6:25586911-25586933 ATCTGATGCCGAGCCGAGGCTGG - Intronic
1005607215 6:27486396-27486418 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1005624736 6:27652941-27652963 CTCTGATGCCGACCCAAGGCTGG + Intergenic
1005644876 6:27828433-27828455 CTCTCATGCCGAGCCAAAGCTGG - Intergenic
1005710721 6:28501594-28501616 CTCTGATGCCGGGCCGAGGCTGG + Intergenic
1005837038 6:29717936-29717958 CTCTCATGCCGAGCCAAAGCTGG + Intergenic
1005863337 6:29917961-29917983 CTCTGATGGCCAGCTGTGGCTGG + Intergenic
1005865191 6:29932102-29932124 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1005929672 6:30474520-30474542 CTCTGATGCCAAGCCGAAGCTGG + Intergenic
1006014310 6:31067969-31067991 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1006065252 6:31456460-31456482 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1006128689 6:31855314-31855336 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1006141668 6:31933073-31933095 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1006149200 6:31977001-31977023 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1006225210 6:32531582-32531604 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
1006232590 6:32596744-32596766 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1006282047 6:33060710-33060732 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1006346469 6:33486520-33486542 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1006403990 6:33833503-33833525 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1006470680 6:34227058-34227080 ATCTGGTGGCCAGCCCAGGCTGG - Intergenic
1006546495 6:34785865-34785887 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
1006617403 6:35339784-35339806 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1006826702 6:36941059-36941081 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1007545140 6:42687441-42687463 CTCTGATGCCGAGCCGAGGCTGG - Intronic
1007651363 6:43424698-43424720 CTCTGATGCCGAGCAGAAGCTGG + Intergenic
1008106461 6:47444593-47444615 CTCTGATGCCGAGTCGAGGCTGG - Intergenic
1008112367 6:47506748-47506770 CTCTCATGCGGAGCCGAAGCTGG - Intronic
1008184491 6:48372018-48372040 CTCTGATGCCGAGCGGAAGCTGG - Intergenic
1008377764 6:50810726-50810748 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1008480537 6:51981384-51981406 CTCTGATGCCGAGCCAAGGCTGG + Intronic
1008553913 6:52656877-52656899 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1008624911 6:53306161-53306183 CTCTCATGCCGAGCCAAAGCTGG - Intronic
1008841767 6:55910944-55910966 CTCTGATGCCGAGTCGAAGCTGG - Intergenic
1008919087 6:56824047-56824069 CTCTGATGCCGAGTCGAAGCTGG + Intronic
1008926779 6:56895974-56895996 CTCTCATGCCGAGCCAAAGCTGG - Intronic
1009041890 6:58190071-58190093 CTCTAATGCCGAGCCAAGGCTGG + Intergenic
1009048929 6:58257162-58257184 CTCTGATGCCAAGCCGAAGCTGG + Intergenic
1009217743 6:60944339-60944361 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
1009622819 6:66097541-66097563 CTCTGATGCCAAGCAGAAACTGG - Intergenic
1010146825 6:72680006-72680028 CTCTGTCACCCAGCCCAGGCTGG - Intronic
1010192203 6:73206306-73206328 CTCTAATGCCGAGCCGAAGCTGG - Intergenic
1010246146 6:73661656-73661678 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1010264576 6:73851910-73851932 CTCTGAGGCCAAGCTGAAGCTGG - Intergenic
1010300774 6:74255922-74255944 CTCTAATGCCGAGCCGAAGCTGG - Intergenic
1010400761 6:75442711-75442733 CTCTGATGCCGAGCCAAGGCTGG - Intronic
1011297088 6:85837987-85838009 CTCTGATGCCGAGCGGAAGCTGG + Intergenic
1011426985 6:87240309-87240331 CTCTGATGCCGAGCTGAAGCTGG - Intronic
1011474363 6:87736778-87736800 CTCTGATGCCAAGCCGAAGCTGG - Intergenic
1011476271 6:87752041-87752063 CTCTCATGCCCAGCCGAAGCTGG - Intergenic
1011587920 6:88946693-88946715 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1012428538 6:99141415-99141437 CTCTGATGCTGAGCCGAAGCTGG + Intergenic
1012479537 6:99650989-99651011 CTCTGATGCCCAGCCGAAGCTGG - Intergenic
1012899750 6:104991967-104991989 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1012983856 6:105854845-105854867 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1013190758 6:107802782-107802804 CCCTGATGCCGAGCCAAAGCTGG + Intronic
1013204404 6:107933759-107933781 CTCTGATGTCTAGCCGAAGCTGG + Intronic
1013243741 6:108269253-108269275 CTCTGATGCCGAGCCGGAGCTGG + Intergenic
1013325836 6:109046132-109046154 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1013530943 6:111018170-111018192 CCCTGATGCCGAGCCGAAGCTGG - Intronic
1013681473 6:112529124-112529146 CACTGATGCCCAGCCGAAGCTGG - Intergenic
1013799996 6:113931625-113931647 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1014123277 6:117750427-117750449 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1014463795 6:121730358-121730380 CTCTGATGCCCAGCCGAGGCTGG - Intergenic
1014557302 6:122850247-122850269 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1014764402 6:125390084-125390106 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1014800192 6:125770238-125770260 CTCAAATGCCGAGCCGAAGCTGG + Intergenic
1015570762 6:134619027-134619049 CTCTATTGCCTAGCCCAGGCTGG - Intergenic
1015643849 6:135364849-135364871 CTCTGATGCCAAGCCGAAGCTGG - Intronic
1016123781 6:140374623-140374645 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1016452301 6:144195578-144195600 CTCTGTTGCCCAGGCCAGGCTGG - Intergenic
1016476612 6:144434300-144434322 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1016480026 6:144470983-144471005 CTCTGATGCCGAGCCAAGGCTGG - Intronic
1016802346 6:148179660-148179682 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
1016973759 6:149787235-149787257 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1017063332 6:150507006-150507028 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1017170244 6:151449687-151449709 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1017465008 6:154686714-154686736 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
1017494003 6:154967340-154967362 CTCTCATGCCGAGCCGAAGCTGG - Intronic
1017660503 6:156669674-156669696 CACTGATGCCAAGCCGAAGCTGG + Intergenic
1017851686 6:158309846-158309868 CTCTGATGCCAAGCCGAAGCTGG - Intronic
1017981760 6:159406781-159406803 CTCTGATGCCAAGCCAAGGCTGG + Intergenic
1018295157 6:162338301-162338323 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1018528298 6:164736966-164736988 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1019386922 7:762455-762477 CTCTGTTGCTCAGCCCAGGCTGG - Intronic
1019445581 7:1069398-1069420 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1019459297 7:1147919-1147941 CTCTGATGCCGAGCCAAGGCTGG - Intergenic
1019651394 7:2161145-2161167 CTCTGATGCCGAGCCGAGGCTGG + Intronic
1019668850 7:2267361-2267383 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1019674276 7:2302141-2302163 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1019715172 7:2535245-2535267 CTCTGATGCCAAGCCAAAGCTGG - Intergenic
1019792583 7:3026536-3026558 CTCTGTTGCCCAGGTCAGGCTGG + Intronic
1020037686 7:4974516-4974538 CTGTGAACCCCAGCCCAGGCGGG + Intergenic
1020157132 7:5736156-5736178 CTCTGATGCCCAGCCGAAGCTGG + Intronic
1020162132 7:5781108-5781130 CTGTGAACCCCAGCCCAGGCGGG - Intronic
1020285068 7:6672386-6672408 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1020480008 7:8647339-8647361 CACTCATGCCCAGCCCTGGCAGG + Intronic
1020498733 7:8889998-8890020 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1020831552 7:13101992-13102014 CTCTGATGCCGAGCAGAAGCTGG + Intergenic
1021120574 7:16790994-16791016 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1021288076 7:18806933-18806955 CTCTGATACCCAAACCAGGCCGG - Intronic
1021440068 7:20667760-20667782 CTCTGATGCCGAGCCAAACCTGG + Intronic
1021647223 7:22800285-22800307 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1021672631 7:23047333-23047355 CTCTGATGCCAAGCCGAAGCTGG - Intergenic
1021735155 7:23635921-23635943 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1021991721 7:26147534-26147556 CTCTGATGCTGAGCAGAAGCTGG + Intergenic
1022005238 7:26261303-26261325 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1022020443 7:26395409-26395431 CTCTGTTGCCCAGGCCAAGCTGG - Intergenic
1022187716 7:27986694-27986716 CTCTGATGCCGAGCTGAGGCTGG + Intronic
1022273946 7:28838230-28838252 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1022317927 7:29263067-29263089 CTCTGATGCCGAGCCGAGGCTGG + Intronic
1022700173 7:32753211-32753233 CTCTGATGCCGAGCGGAGGCTGG + Intergenic
1023160422 7:37291986-37292008 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1024304986 7:47921951-47921973 CTCTGATGCCAAGCCGAGGCTGG + Intronic
1024309685 7:47958860-47958882 CACTGATGCCGAGCCGAAGCTGG + Intronic
1024538536 7:50458995-50459017 CACTGATGCCCAGCCGAAGCTGG + Intronic
1024625662 7:51207468-51207490 CTCTGATGCCGAGCCGAAGCAGG + Intronic
1024931441 7:54668680-54668702 CTCTGATGCCTAGCCGAAGCTGG - Intergenic
1024989369 7:55221136-55221158 CTCTCATGCGGAGCCGAAGCTGG - Intronic
1025000425 7:55311260-55311282 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1025011789 7:55403400-55403422 CCCTGATGCCGAGCCAAAGCTGG - Intronic
1025573157 7:62600606-62600628 CTCTGATGCTGAGCTGAAGCTGG - Intergenic
1025775006 7:64553624-64553646 CTCTGATGCCAAGCCGAGGCTGG + Intronic
1025778185 7:64576911-64576933 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1025793510 7:64717362-64717384 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
1025796180 7:64739523-64739545 CTCTGATGCTGAGCCAAGGCTGG - Intergenic
1025800670 7:64784149-64784171 CTCAGATGCCGAGCCGAAGCTGG + Intergenic
1025803826 7:64810404-64810426 CTCTCATGCTGAGCCGAAGCTGG - Intronic
1025808117 7:64855560-64855582 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1025821796 7:64969027-64969049 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1025828832 7:65033000-65033022 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1025852678 7:65257432-65257454 CTCTGATGCCGAGCTGAAGCTGG + Intergenic
1025971249 7:66328054-66328076 CTCTGTTACCCAGACCAGGCTGG + Intronic
1025979682 7:66395029-66395051 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1026007874 7:66614108-66614130 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1026323169 7:69285000-69285022 CTCTGTTGCTCAGGCTAGGCTGG - Intergenic
1026389282 7:69883546-69883568 CTCTGATGACCAGCAGATTCTGG - Intronic
1026783611 7:73285271-73285293 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1026818800 7:73532773-73532795 CTCTGTCGCCCAGGCCAGGCTGG + Intergenic
1026862242 7:73798039-73798061 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1026868055 7:73835262-73835284 CTCTCATGCTGAGCCGAAGCTGG + Intronic
1027183109 7:75953276-75953298 CTCTGATGCCCAGCCGAAGCTGG - Intronic
1027266454 7:76497615-76497637 CTCTGCTGCCGAGCGGGGGCAGG - Intronic
1027317835 7:76995733-76995755 CTCTGCTGCCGAGCGGGGGCAGG - Intergenic
1027368746 7:77485828-77485850 CTCTGATGCCCAGCTCAGTCTGG - Intergenic
1027625079 7:80534384-80534406 CTCTGTTGCCCAGGCTAGACTGG - Intronic
1027978328 7:85186290-85186312 CTCTGCTGCCCAGACCAGGAGGG + Intronic
1028126429 7:87118499-87118521 CTCTGATGCCCAGCTGACTGGGG + Intergenic
1028227616 7:88267351-88267373 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1028595824 7:92545769-92545791 CTCTGATGCCGAGAGGAGGCTGG - Intergenic
1029067302 7:97863636-97863658 CTCAGTCGCCCAGCCCAGGCTGG - Intronic
1029279291 7:99426227-99426249 CTCTGATGCCCAGCTGAAGCTGG + Intronic
1029334746 7:99889166-99889188 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1029430292 7:100524523-100524545 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1029469133 7:100742813-100742835 CTCTCATGCGGAGCCGAAGCTGG - Intronic
1029525556 7:101091826-101091848 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1029569475 7:101360253-101360275 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
1029569502 7:101360367-101360389 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1030036475 7:105411702-105411724 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
1030288149 7:107847591-107847613 CTCTGGTGCCGAGCCCAAGCTGG + Intergenic
1030329217 7:108255205-108255227 CTCTGATGCGGAGCAGAGGCTGG + Intronic
1030602581 7:111609348-111609370 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1030692543 7:112551057-112551079 CTCTGATGCTGAGCGGAAGCTGG + Intergenic
1030706486 7:112697985-112698007 CTCTGATGCCAAGCGGAAGCTGG - Intergenic
1030725549 7:112921994-112922016 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1031977567 7:128103753-128103775 CCCTGAGGCCCAGGAGAGGCCGG + Intergenic
1032043060 7:128577649-128577671 CACTGATGCCGAGCCAAAGCTGG - Intergenic
1032056516 7:128688839-128688861 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1032157065 7:129477132-129477154 CTCTGATGCCGAGCGGAAGCTGG - Intronic
1032290930 7:130590294-130590316 CTCTCATGCCGAGCCGAAGCTGG + Intronic
1032494711 7:132352351-132352373 GTCTGCTGCCCAGCCTCGGCAGG - Intronic
1032569386 7:132984101-132984123 CCCTGATGCCGAGCCAAAGCTGG + Intronic
1032589235 7:133177015-133177037 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1032648663 7:133854078-133854100 CACTGATGCCCTGATGAGGCAGG - Intronic
1033173029 7:139100881-139100903 CTCTGATGCGGAGCCGAGGCTGG + Intronic
1033219904 7:139521005-139521027 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1033293910 7:140114206-140114228 CTCTGATGCCAAGCGGAAGCTGG + Intronic
1033323601 7:140361587-140361609 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1033332962 7:140431017-140431039 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1033565545 7:142574963-142574985 CTCTGATGCGGAGCCGAGGCTGG + Intergenic
1034034294 7:147802733-147802755 CTCTGATGCCGAGCGGAAGCTGG - Intronic
1034233818 7:149553582-149553604 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1034320981 7:150181562-150181584 CTCTGTTGCCCAGGCTGGGCTGG - Intergenic
1034322350 7:150197893-150197915 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1034442007 7:151090430-151090452 CTCTGCTGGCCAGGCCAGGCCGG - Intronic
1034639016 7:152587190-152587212 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1034723705 7:153316116-153316138 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1034723709 7:153316149-153316171 CTCTGATGCTGAGCCAAAGCTGG - Intergenic
1034771765 7:153785675-153785697 CTCTGTTGCCCAGGCTGGGCTGG + Intergenic
1034961975 7:155368391-155368413 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1036095836 8:5724757-5724779 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1036261730 8:7246660-7246682 CTCTGCTGCCCAGCCTCCGCAGG + Intergenic
1036313770 8:7705205-7705227 CTCTGCTGCCCAGCCTCCGCAGG + Intergenic
1036483132 8:9154833-9154855 CTCTCATGCTGAGCCGAAGCTGG - Intronic
1036698193 8:10993200-10993222 CTCTCGCGCCCAGGCGAGGCTGG + Intronic
1036737049 8:11329352-11329374 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1036761835 8:11514756-11514778 TTCTGATGCTCAGCCAGGGCTGG - Intronic
1037134739 8:15446684-15446706 CTCTGATGCCGAGCCGAGGCTGG - Intronic
1037339344 8:17826114-17826136 CTCTGTCACCCAGCCCAGGCTGG - Intergenic
1037756423 8:21712964-21712986 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1038167810 8:25102472-25102494 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
1038594952 8:28880297-28880319 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1038745039 8:30247840-30247862 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1039072430 8:33659180-33659202 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1039153551 8:34530153-34530175 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1039201167 8:35095032-35095054 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1039400615 8:37265975-37265997 CACTGATGCTCAGGCAAGGCTGG + Intergenic
1039459361 8:37730445-37730467 CTCTGTCGCCCAGGCCAGGCTGG - Intergenic
1039488046 8:37927162-37927184 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1039753319 8:40497184-40497206 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1039881350 8:41627223-41627245 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1040041490 8:42919899-42919921 CTCTGATGCCGAGCCAAGGCTGG - Intronic
1040043673 8:42940439-42940461 CTCTGATGCCGAGCCGAGGCTGG - Intronic
1040053014 8:43033932-43033954 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1040070174 8:43181050-43181072 CTCTGATGCCGAGCCAAGGCTGG - Intronic
1040093525 8:43420449-43420471 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
1040121489 8:43688597-43688619 GTCTCATGCCGAGCCGAAGCTGG - Intergenic
1040488250 8:47895040-47895062 CTCTGTTGCCCAGGCTAGGTAGG - Intronic
1040785335 8:51158489-51158511 CCCTGATGCCGAGCCAAAGCTGG + Intergenic
1040818487 8:51533532-51533554 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1041066119 8:54085039-54085061 CTCTGATGCCGAGACGAGGCTGG + Intronic
1041270646 8:56105568-56105590 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1041287153 8:56272940-56272962 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1041513740 8:58677206-58677228 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1041790769 8:61693990-61694012 CACCGAGGCCCAGCTGAGGCTGG - Intronic
1041796821 8:61754028-61754050 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1041921010 8:63180931-63180953 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1042133858 8:65616171-65616193 CTCTGATGCCGAGCGGAAGCTGG + Intronic
1042139177 8:65662136-65662158 CTCTGATGCCGAGCGGAAGCTGG + Intronic
1042195906 8:66231701-66231723 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1042287920 8:67135198-67135220 CTCTGTTGCCCAGCCTAGGCTGG + Intronic
1042290893 8:67168254-67168276 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1042303384 8:67310146-67310168 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1042475524 8:69245056-69245078 CTCTCATGCCAAGCGGAAGCTGG + Intergenic
1042912685 8:73844187-73844209 CTCTGATGCCAAGCCAAGGCTGG + Intronic
1043404805 8:79919527-79919549 CTATGTTGCCCAGGCCAGGCTGG + Intronic
1043958700 8:86390651-86390673 CTCTGATGCTGAGCCGAGGCTGG - Intronic
1043961759 8:86424762-86424784 CTCTGATGCCAAGCCGAAGCTGG - Intronic
1043986174 8:86695254-86695276 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1044223532 8:89698213-89698235 CTCTGATGCTGAGCTGAAGCTGG + Intergenic
1044507468 8:93038650-93038672 CTCTGATGCTGAGCCGAAGCTGG + Intergenic
1044969283 8:97604393-97604415 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1045022059 8:98052474-98052496 CTCTGATGCCGAGCGGAGGCTGG - Intergenic
1045120606 8:99029733-99029755 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1045188598 8:99861918-99861940 GGCTGATGCCCAGCCGGGACAGG - Exonic
1045195507 8:99926658-99926680 CTCTGATGCCGAGCGGAAGCTGG + Intergenic
1045235642 8:100350797-100350819 CTCTGATGCCGAGCGGAGGCTGG + Intronic
1046599117 8:116297094-116297116 CTCTGATGCCAAGCCGAGGCTGG + Intergenic
1046636110 8:116678028-116678050 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1046735926 8:117777148-117777170 CTCTGATGCCAAGCCAAGGCTGG + Intergenic
1047388756 8:124432788-124432810 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1048368219 8:133756945-133756967 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
1049169572 8:141150991-141151013 CTCTGATGCCCCACTAAGGCAGG - Intronic
1049169645 8:141151529-141151551 CTGTGTTGCCCAGCCCAGGCTGG - Intronic
1049177574 8:141203107-141203129 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1049400016 8:142421141-142421163 CTCTGTTGCCCAGCCCAGTCTGG - Intergenic
1049485464 8:142856934-142856956 CTCTGATGCTGAGCCGAAGCTGG - Intronic
1049504077 8:142985581-142985603 CTCTAATGCTCAGCCAAGGCAGG + Intergenic
1049716868 8:144097076-144097098 CTCAGATGCCCAGCGCAGGAAGG - Exonic
1049747427 8:144268928-144268950 CTGTGCTGCCCAGCGGAGGGGGG + Intronic
1049892563 9:83872-83894 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1050461230 9:5879337-5879359 CTCTGTTGCCCTTCCCAGGCTGG - Intergenic
1050557219 9:6799522-6799544 CTCTCATGCCAAGCCGAAGTTGG - Intronic
1050572023 9:6949799-6949821 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1050862181 9:10449078-10449100 CTCTGATGCCCAGCCGAGGCTGG + Intronic
1051257899 9:15233394-15233416 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1051281205 9:15443128-15443150 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1051430793 9:16978288-16978310 CTCTGATGCCAAGCCGAAGCTGG - Intergenic
1051662045 9:19434730-19434752 CTCTCATGCCGAGCCGAAGCTGG - Intronic
1051772755 9:20596658-20596680 CTTTGTGGCCCAGCCCAGGCTGG - Intronic
1052492998 9:29189969-29189991 CTCTGATGCCCAGCCAAAGCTGG - Intergenic
1052880889 9:33600326-33600348 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1052887863 9:33667148-33667170 CTCTGATGCTGAGCTGAAGCTGG + Intergenic
1052928533 9:34038321-34038343 CTCTGATGCCAAGCCAAAGCTGG + Intronic
1052935072 9:34086158-34086180 CTCTGAGGTCCAGCTGAGGGTGG - Intergenic
1052941754 9:34136877-34136899 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1053047957 9:34936107-34936129 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1054359563 9:64100386-64100408 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1055034721 9:71806116-71806138 CTCTGTTGCCCAGGCCAGGCTGG - Intronic
1055134093 9:72807210-72807232 CTCTCATGCTGAGCCGAAGCTGG - Intronic
1055241926 9:74196883-74196905 CTCTGATGCCCAGCCGAAGCTGG + Intergenic
1055506520 9:76954902-76954924 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1055519041 9:77061560-77061582 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
1055580718 9:77703779-77703801 CTCTGATGCCTAGCCGAGACTGG - Intergenic
1055585892 9:77760245-77760267 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1055948110 9:81709589-81709611 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1056097656 9:83272142-83272164 CTCTGATGCCTAGCTGAAGCTGG + Intronic
1056152339 9:83803291-83803313 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1056166646 9:83947552-83947574 CTCTGATGCCGAGGGGAGGCTGG + Intronic
1056336282 9:85573142-85573164 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1056409434 9:86311658-86311680 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1056564570 9:87759851-87759873 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1056592365 9:87974065-87974087 CTCTCTTTCCCAGCCGAGGGTGG - Intronic
1056625026 9:88245900-88245922 CCCTGATGCCGAGCCAAAGCTGG - Intergenic
1056639667 9:88359655-88359677 CTCTGTTGCCCAGGCCAAGCTGG + Intergenic
1056670707 9:88625530-88625552 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1057022449 9:91709929-91709951 CTCTGTCGCCCAGGCCAGGCTGG - Intronic
1057155264 9:92832416-92832438 CTCTGATGCCGAGCCGAAACTGG - Intergenic
1057598495 9:96437045-96437067 CTCTGCTGCTCAGCTGAGGCAGG - Intergenic
1057716337 9:97498850-97498872 CTCTGATGCCCAGCGGAGGCTGG - Intergenic
1058018688 9:100067229-100067251 CTCTGATGCCGAGCGGAAGCTGG + Intronic
1058390565 9:104490536-104490558 CTCTGATGCCGAGCGGAGGCTGG - Intergenic
1058660116 9:107258454-107258476 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1058722351 9:107775405-107775427 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1058972786 9:110098118-110098140 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1059118274 9:111618202-111618224 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1059120617 9:111639975-111639997 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1059707943 9:116841334-116841356 CTCTCATGCCGAGCCGAAGCTGG - Intronic
1059880103 9:118679004-118679026 CTCTGATGCCCAGCCGAGGCTGG - Intergenic
1060041375 9:120304395-120304417 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1060334657 9:122710827-122710849 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1060349933 9:122851535-122851557 CTCTCATGCCGAGCCGAAGCTGG + Intronic
1060351627 9:122866443-122866465 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1060369818 9:123058010-123058032 CTCTGATGCCGAGCCGAGGCTGG - Intronic
1060625411 9:125107870-125107892 CTCTGATGCCGAGCGGAAGCTGG + Intronic
1060651288 9:125329080-125329102 CTCTCATGCGGAGCCGAAGCTGG - Intronic
1060669943 9:125459772-125459794 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1060682180 9:125576557-125576579 CTCTGATGCCCAGCCGAAGCTGG + Intronic
1060686888 9:125622845-125622867 CTCTCATGCGGAGCCGAAGCTGG + Intronic
1060704039 9:125781477-125781499 CTCTGATGCCTAGCCGAAGCTGG - Intronic
1061142931 9:128779556-128779578 CTCTGATGCCCAGCCGAGGCTGG + Intergenic
1061427300 9:130507313-130507335 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1061635668 9:131907257-131907279 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1061977152 9:134075198-134075220 CTCTGATACCCAGCCGAGGCTGG + Intergenic
1203464180 Un_GL000220v1:69306-69328 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1203562475 Un_KI270744v1:70815-70837 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1203634550 Un_KI270750v1:97965-97987 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
1185559471 X:1048390-1048412 CTCTGTTGCCCAGCCTGGGGTGG - Intergenic
1185704282 X:2254992-2255014 CTCTGTTGCCCAGGCCGGGCTGG + Intronic
1186245304 X:7610255-7610277 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
1186786729 X:12962680-12962702 CTCTGATGCCAAGCCGAAGCTGG + Intergenic
1186923112 X:14303417-14303439 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1187183860 X:16966067-16966089 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1187212695 X:17245761-17245783 CTCTGATGCCGAGTGGAAGCAGG - Intergenic
1187405108 X:18996763-18996785 CTCAGGTGCCCAGTCAAGGCAGG + Intronic
1188086264 X:25905295-25905317 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1188368136 X:29335220-29335242 CTCTGATGCCGAGCCAAAGCTGG - Intronic
1188476930 X:30601541-30601563 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1188492850 X:30754723-30754745 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1189057021 X:37708163-37708185 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1189210043 X:39276927-39276949 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1189505707 X:41611737-41611759 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1189570187 X:42286575-42286597 CTCTGATGCCGAGCCAAAGCTGG - Intergenic
1189587426 X:42474930-42474952 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1189825435 X:44911984-44912006 CTCTGATGCTGAGCCAAAGCTGG - Intronic
1189838231 X:45042209-45042231 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1189955642 X:46274758-46274780 CTCTCATGCGGAGCCGAAGCTGG + Intergenic
1189968764 X:46396956-46396978 CTCTCATGCCGAGCCGAAGCTGG - Intergenic
1190158894 X:48016343-48016365 CTCTGATGCAGAGCCAAGGCTGG + Intronic
1190171349 X:48114680-48114702 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1190174591 X:48138608-48138630 CTCTGGTGCAGAGCCGAGGCTGG + Intergenic
1190184380 X:48221827-48221849 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1190241546 X:48660525-48660547 CTCTCATGTCGAGCCGAAGCTGG - Intergenic
1190505428 X:51120444-51120466 CTCCGATGCCGAGCGGAGGCTGG - Intergenic
1190520952 X:51279335-51279357 CTCTCATGCCGAGCCGAAGCTGG + Intergenic
1190681083 X:52827734-52827756 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1190733899 X:53242664-53242686 CTCTGGTGCCCAGCAAATGCTGG + Intronic
1190769459 X:53503446-53503468 CTCTGATGCTGAGCCAAAGCTGG + Intergenic
1190778803 X:53577557-53577579 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1190793468 X:53721176-53721198 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1190820147 X:53966270-53966292 CTCTGATGCCGAGCTGAAGCTGG + Intronic
1190839325 X:54129977-54129999 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1190848383 X:54215229-54215251 CTCTGATGCCCAGCCCAGGCTGG + Intronic
1190891671 X:54573464-54573486 CTCTCATGCCCAGCCGAAGCTGG - Intergenic
1191009717 X:55747906-55747928 CCCTGATGCCGAGCCGAAGCTGG + Intronic
1191069155 X:56381123-56381145 CTCTGATGCTGAGCCGAAGCTGG - Intergenic
1191637205 X:63392473-63392495 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1191679506 X:63826275-63826297 CTCTGATGCCGAGCCGAGGCTGG - Intergenic
1191835205 X:65456477-65456499 CTCTGATGCCGAGCCAAAGCTGG + Intronic
1191894343 X:65976001-65976023 CTCTGATGCCCAGCTGAGGCTGG - Intergenic
1192106833 X:68325904-68325926 CTCTCATGCCGAGCCAAAGCTGG + Intronic
1192324680 X:70122482-70122504 CTCTGATGCCGAGCGGAGGCTGG + Intergenic
1192353057 X:70372600-70372622 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1192386654 X:70679004-70679026 CTCTGATGCCGAGCTGAAGCTGG + Intronic
1192464238 X:71342487-71342509 CTCTGATGCCGAGCTGAAGCTGG - Intergenic
1192477164 X:71453018-71453040 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1192500300 X:71645825-71645847 CTCTGATGCTGAGCCAAGGCTGG - Intergenic
1192530392 X:71877702-71877724 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1192567537 X:72177981-72178003 CTCTGATGCCGAGCCAAGGCTGG + Intergenic
1192610096 X:72559110-72559132 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1192761149 X:74097808-74097830 CTCTGATGCCAAGCCAAGGCTGG + Intergenic
1192768361 X:74165749-74165771 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1192794311 X:74413310-74413332 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1192813666 X:74569773-74569795 CTCTGATGCCGAGCGGAAGCTGG - Intergenic
1192970062 X:76219167-76219189 CTCTCATGCGGAGCCGAAGCTGG - Intergenic
1193067910 X:77278741-77278763 CTCTGATGCCGAGCCGAAGCTGG + Intergenic
1193115012 X:77767177-77767199 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1193132574 X:77932862-77932884 CTCTAATGCCGAGCCGAAGCTGG - Intronic
1193152059 X:78135563-78135585 CTCTGTTACCCAGGCCAGGCTGG - Intronic
1193164781 X:78266397-78266419 CTCTGATGCCGAGCTGAGGCTGG - Intergenic
1193209482 X:78789269-78789291 CTCTGTTTCCCAGCCAAGGGAGG + Intergenic
1193328843 X:80214538-80214560 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1193345421 X:80397886-80397908 CTCTGATGCCGAGCCGAAGCTGG - Intronic
1193362039 X:80590427-80590449 CTCTGATGCCAAGCCAAAGCTGG + Intergenic
1193372195 X:80712187-80712209 CTCTGATGCCGAGCCGAAGCTGG + Intronic
1193890141 X:87033930-87033952 CCCTGATGCCGAGCGGAGGCTGG - Intergenic
1194181052 X:90713147-90713169 CTCTGATGCCAAGCTGAGGCTGG + Intergenic
1194714838 X:97276234-97276256 CTCAGATGCCGAGCCGAAGCTGG - Intronic
1195257692 X:103105237-103105259 CTCTGATGCCGAGCCGAAGCTGG - Intergenic
1195888811 X:109670664-109670686 CTCTGATGCCGAGCGGAGGCTGG + Intronic
1196778376 X:119361434-119361456 CTCTGATGCCGAGCCGAGGCTGG + Intergenic
1197199148 X:123733568-123733590 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1197452786 X:126640792-126640814 CTCTGATGCCGAGCGGAAGCTGG + Intergenic
1197455507 X:126673257-126673279 CTCTGATGCCGAGCCGATGCTGG + Intergenic
1197735762 X:129849820-129849842 CACTGATGCCGAGCCAAAGCTGG + Intergenic
1198189277 X:134286667-134286689 CTCTGATGCCGAGCGGAGGCTGG - Intergenic
1198246702 X:134838732-134838754 CTCTGATGCCGAGCGGAAGCTGG + Intronic
1198260280 X:134959778-134959800 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1198476728 X:137001625-137001647 CACTGATGCCGAGCCGAAGCTGG - Intergenic
1198600947 X:138283408-138283430 CTCTGATGCCAAGCCGAGGCTGG - Intergenic
1199230815 X:145435665-145435687 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1199586278 X:149420177-149420199 CTCTCATGCTGAGCCGAAGCTGG + Intergenic
1199836911 X:151600221-151600243 CTCTGATGCCGAGCTAAGGCTGG - Intronic
1200098587 X:153675940-153675962 CTATGTTGCCCAGGCTAGGCTGG - Intronic
1200148355 X:153939118-153939140 CTCTGTTGCCCAGCCCAGGCTGG + Intronic
1200324733 X:155224559-155224581 CTCTGATGCCGAGCCGAGGCTGG - Intronic
1200387568 X:155908496-155908518 CTCTGATGCCCAGCCGAAGCTGG - Intronic
1200527673 Y:4295036-4295058 CTCTGATGCCGAGCTGAGGCTGG + Intergenic
1200953058 Y:8918854-8918876 CTCTGATGCCTAGCCGAAGCTGG - Intergenic
1201335645 Y:12878171-12878193 CTCTGATGCCGAGCCAAAGCTGG + Intergenic
1201948171 Y:19535238-19535260 CCCTGATGCCGAGCGGAGGCTGG + Intergenic