ID: 1082707444

View in Genome Browser
Species Human (GRCh38)
Location 11:56509705-56509727
Sequence CTCTGATACAAAGAGTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082707444_1082707446 -3 Left 1082707444 11:56509705-56509727 CCTGCCTACTCTTTGTATCAGAG 0: 1
1: 0
2: 0
3: 15
4: 210
Right 1082707446 11:56509725-56509747 GAGCCTCACACAAGAACTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 177
1082707444_1082707448 28 Left 1082707444 11:56509705-56509727 CCTGCCTACTCTTTGTATCAGAG 0: 1
1: 0
2: 0
3: 15
4: 210
Right 1082707448 11:56509756-56509778 ATTGAAGAACTGAAGAGACAAGG 0: 1
1: 1
2: 4
3: 33
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082707444 Original CRISPR CTCTGATACAAAGAGTAGGC AGG (reversed) Intergenic
901267772 1:7925145-7925167 CTCTAATACAAAAATTAGCCAGG + Intronic
902863755 1:19263983-19264005 CTCTGATTCCAAGAGTTGGATGG - Intergenic
906158841 1:43631839-43631861 TTATAATACAAAAAGTAGGCGGG - Intergenic
907168358 1:52436187-52436209 CTCAAATCCAAAGAATAGGCTGG + Intronic
908535387 1:65071989-65072011 CCTTAAAACAAAGAGTAGGCTGG + Intergenic
909094566 1:71271161-71271183 CACTGATACAGACAGGAGGCAGG - Intergenic
914864602 1:151416045-151416067 CTCTAATACAAAAATTAGCCGGG + Intronic
915608251 1:156969036-156969058 CTGTTATATAAAGAGTAGGGTGG - Intronic
917661010 1:177176832-177176854 CTCACATACAAAGAGTGAGCCGG + Intronic
922644733 1:227275641-227275663 CTCTGATGCCAAGCGGAGGCTGG + Intronic
923023769 1:230188088-230188110 TTATGATACAAACAGGAGGCAGG - Intronic
1063563348 10:7149528-7149550 CTCTAATACAAAAATTAGCCAGG + Intergenic
1064506863 10:16040769-16040791 CTCTGATTAAAAGAGAAAGCAGG + Intergenic
1065802247 10:29363208-29363230 CTCTGATACCAGGAGTAAGGTGG + Intergenic
1067012221 10:42724875-42724897 CTCTGATACCAAGACTATCCAGG - Intergenic
1067311376 10:45117018-45117040 CTCTGATACCAAGACTATCCAGG + Intergenic
1069447746 10:68489440-68489462 ATCTGATAAAAATAGTATGCAGG + Intronic
1072689017 10:97558235-97558257 CTCTGATACCAGGAGTAAGGTGG + Intronic
1073578969 10:104646548-104646570 CTGTGATAGAAAGATTTGGCTGG + Intronic
1074070058 10:110058576-110058598 CTCTGATGTAAAGGGTAAGCTGG + Intronic
1074572078 10:114633249-114633271 CTCTGAGTCAAAGAGGAGGCAGG - Intronic
1076314684 10:129532159-129532181 CTCTCATCCAAAGGGCAGGCTGG - Intronic
1079595904 11:22246127-22246149 ATCAGATACAAAGAGAAGACTGG - Intronic
1082707444 11:56509705-56509727 CTCTGATACAAAGAGTAGGCAGG - Intergenic
1082740081 11:56901128-56901150 CTCTGTTCCAAAGAGTGGGATGG + Intergenic
1085472730 11:76768502-76768524 ATCTGCTTCAAGGAGTAGGCCGG - Intergenic
1086114251 11:83230433-83230455 CACGGACACAAAGAGTAGGATGG - Intronic
1090302391 11:125654726-125654748 CTCTAATACAAAGAGTACTGCGG - Intronic
1091669297 12:2440977-2440999 CTCTCAGACAGAGAATAGGCAGG + Intronic
1091991091 12:4956488-4956510 TTATGATACAAAGAGGAGGCTGG + Intergenic
1093348801 12:18071429-18071451 CTCTTTTACAAAAAGAAGGCAGG + Intergenic
1095801110 12:46269971-46269993 GTCTGAAACAAAGAGTAAGCGGG - Intronic
1101520795 12:105480295-105480317 CTCTGCGATAAAGAGCAGGCCGG + Intergenic
1102158555 12:110749632-110749654 ATCTAATACAAAAATTAGGCGGG + Intergenic
1104011240 12:124931731-124931753 CTCTAATACAAAAATTAGCCAGG + Intergenic
1106815213 13:33400161-33400183 CTCTGAAGCAGAGAGTAGGATGG - Intergenic
1108685733 13:52817511-52817533 CTCTGATACCAAGCGGAGGCTGG + Intergenic
1109802954 13:67401567-67401589 CTCTGATACTGGGAGTAGGGTGG - Intergenic
1110906718 13:80898664-80898686 CTCTGATTTGAAGAGTAGGATGG + Intergenic
1112592008 13:100772203-100772225 ATCAGAAACAAAGAGTAGGCCGG - Intergenic
1114070372 14:19100364-19100386 CTCTGCTACAAAAATTAGCCAGG + Intergenic
1114091889 14:19299638-19299660 CTCTGCTACAAAAATTAGCCAGG - Intergenic
1114359985 14:21960879-21960901 CTCTGAGACAAAGAGCAAGCTGG - Intergenic
1118696971 14:68394908-68394930 CACTGAGAAAAAGAGCAGGCGGG - Intronic
1120218436 14:81705325-81705347 CACTGATACAGACAGAAGGCAGG - Intergenic
1120983643 14:90313541-90313563 CTCTGAACCAATGTGTAGGCTGG + Intronic
1121568263 14:94926786-94926808 CTCAAAAACAAAGAGCAGGCTGG - Intergenic
1126272456 15:46836353-46836375 CTCTGATACAAAGAGTATAAAGG - Intergenic
1128687878 15:69700313-69700335 CTCTGAAACCAAGAGCAGGCAGG + Intergenic
1130864579 15:87921483-87921505 CTCTGAGACCAGGAGTAGGGAGG - Intronic
1131331893 15:91508167-91508189 CTCAGAAACAGAGAGTAGGATGG + Intergenic
1132876575 16:2141824-2141846 CTTTAAAAGAAAGAGTAGGCTGG + Intronic
1134348320 16:13412558-13412580 CTCAGATTCAAAAAGGAGGCCGG + Intergenic
1135015293 16:18919928-18919950 CTCTAATACAAAAATTAGCCGGG + Intronic
1135320909 16:21495735-21495757 CTCTAATACAAAAATTAGACGGG + Intergenic
1135373744 16:21927237-21927259 CTCTAATACAAAAATTAGACGGG + Intergenic
1135431141 16:22384454-22384476 CTCTAATACAAAAATTAGCCAGG + Intronic
1135438043 16:22443481-22443503 CTCTAATACAAAAATTAGACGGG - Intergenic
1136447089 16:30328953-30328975 CTCTAATACAAAAATTAGCCGGG + Intergenic
1136559596 16:31031305-31031327 CTCAGAGACACAGAGTAGGAGGG + Intergenic
1139637476 16:68266572-68266594 CTCTGCAACAAAGAGTGGGAGGG - Exonic
1140703579 16:77605258-77605280 CTTTGAAACAAAGATTAGGGAGG + Intergenic
1143123845 17:4628073-4628095 CTCTGATGCAGAGTGTAGGAGGG + Intergenic
1143426298 17:6841809-6841831 CTCTGATGCAGAGTGTAGGAGGG - Intergenic
1143836675 17:9698576-9698598 CTCTGATACAAAAAGAAAGAGGG - Intronic
1145952005 17:28825933-28825955 CTTTTATACAAAAATTAGGCGGG - Intronic
1146308165 17:31746531-31746553 TTCTGATACAAAGGGTGGACTGG - Intergenic
1148347635 17:46914053-46914075 TTCTAAAACACAGAGTAGGCTGG - Intergenic
1148959077 17:51378058-51378080 CTGTGATACATAAAGGAGGCTGG - Intergenic
1149237034 17:54604519-54604541 CTCTGACACAAAAACTAGGGAGG - Intergenic
1150200521 17:63352080-63352102 CTCAGCTACAATGAGAAGGCTGG - Intronic
1150318846 17:64192853-64192875 ATCTGAAACAAAGACTAGGAGGG - Intronic
1150894781 17:69196971-69196993 CTCTGATGCCAAGCGGAGGCTGG - Intronic
1151132036 17:71907253-71907275 CTTTAATACAAAGTGTGGGCCGG + Intergenic
1157466325 18:47949362-47949384 CTCTGATACATGGAAAAGGCTGG + Intergenic
1157896454 18:51473213-51473235 CTCTGAGACTAAGAGTTGCCAGG + Intergenic
1158807988 18:60998383-60998405 CTCTAAAACAAATAGTGGGCTGG - Intergenic
1159134413 18:64319985-64320007 CAATGATACAAAGAGTGGGAGGG - Intergenic
1161173985 19:2829060-2829082 CTGTGATAAAAAATGTAGGCTGG + Intronic
1162223769 19:9202269-9202291 CTCTAATACAAAAACTAGCCAGG - Intergenic
1162282067 19:9706792-9706814 CTCTGATACCAAGAGCAAGGTGG - Intergenic
1162848852 19:13415200-13415222 CTCCGAGACAGAGAGAAGGCGGG + Intronic
1163934373 19:20428865-20428887 CTCTGATACTAGGAGTAAGGTGG + Intergenic
1166413133 19:42570278-42570300 GTCTAATAAAAAGAGAAGGCAGG - Intergenic
1167751626 19:51384129-51384151 CTCTAATCCAAAGACTGGGCTGG + Intronic
1167942560 19:52959331-52959353 GTCTGATACCAAGAGTAAGGTGG - Intronic
927009743 2:18890531-18890553 CTCTGGTACAAGGAGTTAGCTGG - Intergenic
927262264 2:21103151-21103173 CACTGATACAAACAGGAGGCAGG - Intergenic
928202398 2:29256681-29256703 CTCAGGCCCAAAGAGTAGGCAGG + Intronic
928698122 2:33871477-33871499 TACTGATACAAAGAGGAGACAGG + Intergenic
929386273 2:41411188-41411210 TTAAGATACAAAGATTAGGCCGG + Intergenic
930647864 2:53930979-53931001 CTCTCAAATTAAGAGTAGGCCGG + Intronic
931091459 2:58891056-58891078 CATTGATTCAGAGAGTAGGCTGG - Intergenic
932047100 2:68360757-68360779 CTCTGAGACAAAGTTTGGGCTGG + Intergenic
933250705 2:80025327-80025349 CTCTGATACCGACAGGAGGCAGG - Intronic
934161496 2:89253708-89253730 GCCTGATACAAAGAGAAGCCAGG - Intergenic
934205785 2:89928707-89928729 GCCTGATACAAAGAGAAGCCAGG + Intergenic
935741208 2:106150313-106150335 CTTTGATACACAGAGTAGTATGG + Intronic
937407203 2:121641198-121641220 CTCTGTTACGAACAGTAGCCCGG - Intronic
938019970 2:127898329-127898351 CCCTGGTACAAAGACGAGGCTGG - Intergenic
939497909 2:142946242-142946264 CAATGATACAAAAAGTAGCCAGG - Intronic
940057855 2:149531931-149531953 CCCTGATAAAAATAGTAGCCGGG - Intergenic
943079421 2:183240008-183240030 CTCTGATATAAATAGTTGTCGGG + Intergenic
944493862 2:200286376-200286398 ATCTGATCTAAAGAATAGGCAGG + Intergenic
945614814 2:212054286-212054308 CTCAGACACAGAGAGAAGGCAGG - Intronic
945943131 2:215969633-215969655 CTCTGGCACAAAGGGCAGGCAGG - Intronic
946711865 2:222515160-222515182 CTTTGATACCAAGAGTAGAGTGG - Intronic
946797441 2:223370797-223370819 CTCATATACAAAAATTAGGCAGG - Intergenic
947116951 2:226782085-226782107 CTGTGGTTCAAAGAGTATGCTGG + Intronic
947134163 2:226960382-226960404 CTCTTATGCACAGAGTAAGCTGG - Intronic
1170380317 20:15752524-15752546 AACTGGTACAAAGAGTGGGCAGG - Intronic
1170400941 20:15982660-15982682 CTCTGATACCAGGAGTAAGGTGG + Intronic
1172671501 20:36637361-36637383 CTCTACTACAAAAAGTAGCCAGG - Intronic
1174046209 20:47735780-47735802 CTCAGATACACAGTGTGGGCTGG - Intronic
1174210958 20:48877574-48877596 CTCTGATACAATCACTGGGCAGG + Intergenic
1174469433 20:50745261-50745283 CTCTAATACAAAAATTAGCCGGG + Intronic
1178916683 21:36708967-36708989 CTCTGTTAAAAAGAAAAGGCTGG - Intronic
1180219525 21:46349372-46349394 CTCTGAAACAAAGATCAGGAAGG - Intronic
1180488844 22:15822926-15822948 CTCTGCTACAAAAATTAGCCAGG + Intergenic
1181659713 22:24335356-24335378 AACTGAGGCAAAGAGTAGGCAGG - Intronic
1181829350 22:25546890-25546912 CTGTGAAACAAAGAGTAAGTAGG - Intergenic
1182537611 22:31016985-31017007 CTCTAATACAAAAATTAGCCAGG - Intergenic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
949158069 3:850794-850816 CTCTGATACCAGGAGTAAGGTGG - Intergenic
949635506 3:5977469-5977491 CTATGATAAAAAGAGTTGGCGGG - Intergenic
952123173 3:30268497-30268519 CACTGGTACCAAGAGGAGGCTGG - Intergenic
952354909 3:32575073-32575095 CTCTAATACAAAAATTAGCCAGG - Intergenic
954279001 3:49562456-49562478 CTGTGAGACAAAGAGAAGGCAGG - Intronic
954481503 3:50804696-50804718 CTCTGATGCCAAGCGGAGGCTGG - Intronic
955508995 3:59660473-59660495 ATCTGAGACACAGAGTATGCAGG + Intergenic
956996170 3:74828585-74828607 CTCTGATACCAGGAGTAAGGTGG - Intergenic
958259342 3:91361684-91361706 CTCTGAGACAAAGATTGGTCAGG - Intergenic
959060889 3:101615362-101615384 CTCTGAAGCAGACAGTAGGCTGG + Intergenic
959233489 3:103689362-103689384 CCCTGATTCAAACAGTAGGAGGG + Intergenic
960946717 3:122971888-122971910 CTCTGTTTCAAAGAGAAGGGAGG - Intronic
961486238 3:127218702-127218724 CTGTGAAACAAAGAGTAAGGAGG - Intergenic
963958471 3:151281695-151281717 CTCTGAGAAAAAGATTAGTCAGG - Intronic
964932838 3:162047287-162047309 CTCTGATACCAGGAGTAAGGTGG + Intergenic
965418711 3:168429242-168429264 CCCAGATTCAAGGAGTAGGCTGG + Intergenic
967058289 3:185849063-185849085 TTCTAATAAAAAGAGGAGGCTGG - Intergenic
968287184 3:197515741-197515763 CTGTAATACAAAGATTAGCCGGG + Intronic
968834930 4:2956239-2956261 CACTGGTACAAATATTAGGCTGG + Intronic
968846232 4:3043137-3043159 CTCTAATACAAAAATTAGCCAGG + Intergenic
970839649 4:20452425-20452447 CTCTGATATAATTAGTAGGAAGG - Intronic
971962974 4:33512930-33512952 CTATGATAAAAAGAGTTGCCAGG - Intergenic
972275085 4:37549670-37549692 CTCTGATACCAGGAGTAAGGTGG - Intronic
972772430 4:42209908-42209930 CTCTGATTCAAAGAGAACTCTGG + Intergenic
973253504 4:48085469-48085491 CACTGATACCAACAGGAGGCAGG + Intronic
974033957 4:56800983-56801005 CTAAAATACAAAAAGTAGGCGGG + Intergenic
974988121 4:69054545-69054567 CTCTGATACCAGGAGTAAGGTGG - Intronic
982930915 4:161406833-161406855 CTCTTATACATAGAATAGGGTGG + Intronic
984382842 4:179017414-179017436 TTCTGATACAGACAGGAGGCCGG + Intergenic
985263918 4:188140416-188140438 CTCTAAAACAAAGGGCAGGCTGG - Intronic
985963306 5:3320202-3320224 CTCTGATAAAAAGGGAAGACGGG + Intergenic
986626633 5:9728993-9729015 CTCAGAGAGAAAGAGCAGGCAGG + Intergenic
988777050 5:34486418-34486440 ATCTGTTAGAAAGAGTATGCAGG + Intergenic
989047125 5:37284095-37284117 CTCTGCTACAAAAATTAGCCTGG + Intergenic
989281514 5:39649316-39649338 CTCTCACAAAAAGACTAGGCCGG - Intergenic
990369788 5:55105674-55105696 CATTAATAAAAAGAGTAGGCCGG + Intronic
990485884 5:56258809-56258831 CTCTGATGCCAAGCGGAGGCTGG - Intergenic
990947355 5:61262955-61262977 CTTTCATCTAAAGAGTAGGCCGG + Intergenic
991425773 5:66490114-66490136 CTTTGATACAGACAGGAGGCAGG - Intergenic
992989528 5:82270039-82270061 CTCTGATACCAGGAGTAAGATGG + Intronic
993249648 5:85503257-85503279 CGTTGAAACAAAGAGGAGGCAGG - Intergenic
993880206 5:93352274-93352296 CATTTATACAAAGAATAGGCTGG - Intergenic
994787651 5:104185358-104185380 CTCTGGGACAAAGATTGGGCAGG - Intergenic
996258402 5:121435003-121435025 CTCTGATACAGCTAGAAGGCAGG + Intergenic
1002178954 5:177419874-177419896 CTCTGAAAAAAAGAAAAGGCCGG + Intronic
1003541385 6:7021148-7021170 CTCAGATACAAAAATTAGCCGGG - Intergenic
1006570776 6:35002156-35002178 CTCTGATACCAAGAGTGAGGTGG - Intronic
1009184427 6:60557421-60557443 CTCTGAGACAAAGATTGGTCAGG + Intergenic
1010240626 6:73612318-73612340 CTCTAATACAAAGATTAGCTTGG - Intronic
1011811238 6:91134519-91134541 CACTGATACGAAGAGGAGGGAGG - Intergenic
1011842045 6:91513694-91513716 GTCTAATACATAAAGTAGGCAGG - Intergenic
1012370803 6:98504441-98504463 CTATGAAAAAAAGAGTAGGAAGG - Intergenic
1013559130 6:111286942-111286964 CTCTGATACCAGGAGTAAGGTGG + Intergenic
1016862962 6:148739782-148739804 CTCTTATTTAAAAAGTAGGCTGG - Intergenic
1017004644 6:150021074-150021096 CTCTGAGTCAAAGAGTAGGAAGG + Exonic
1020864287 7:13537468-13537490 AGTTGATCCAAAGAGTAGGCTGG + Intergenic
1021066111 7:16174881-16174903 CTCTCTGACAAAGAGTAGGATGG - Intronic
1021705868 7:23367137-23367159 CTATAATACAAAAAGTAGCCAGG - Intronic
1024864058 7:53882561-53882583 CTCAGATTAAAAGAGTAGGAAGG - Intergenic
1027206861 7:76107253-76107275 CTCTGAGACTAAGTTTAGGCTGG - Intergenic
1028595824 7:92545769-92545791 CTCTGATGCCGAGAGGAGGCTGG - Intergenic
1029025259 7:97410351-97410373 CTCAAATAGAAAGAGTAAGCTGG + Intergenic
1029254573 7:99260904-99260926 CTCTAATACAAAAATTAGCCAGG + Intergenic
1031560999 7:123237973-123237995 CTTTGATATAAGGAGTAAGCAGG + Intergenic
1031600244 7:123699215-123699237 CTCTAATACAAAAATTAGCCGGG + Intronic
1032979403 7:137264642-137264664 CTCTGATACCAGGAGTAAGGTGG + Intronic
1033406753 7:141076761-141076783 CACTGATACCTAGAGTTGGCAGG + Intronic
1035220174 7:157401885-157401907 CTCTGCAACAGAGAGAAGGCAGG - Intronic
1036406502 8:8460174-8460196 ATCTGATACAAAGAGAATGATGG - Intergenic
1036952195 8:13151679-13151701 CTTGGGTGCAAAGAGTAGGCTGG - Intronic
1037376806 8:18239021-18239043 CTCAGAAACAAAGAGTAGAATGG + Intergenic
1038950727 8:32411172-32411194 ATCTGATAAAAAGTGTGGGCTGG - Intronic
1042238632 8:66640437-66640459 CTCTGATACAGAAAGGAGGCAGG + Intronic
1042333601 8:67608147-67608169 TTCTGATACAGACAGGAGGCAGG + Intronic
1043420700 8:80095648-80095670 CTAAAATACAAAGACTAGGCCGG + Intronic
1045509216 8:102800708-102800730 CTCTCAGGCAAAGAGCAGGCAGG + Intergenic
1047351066 8:124074489-124074511 CTCTGATACAAAAATTAGTGGGG + Intronic
1047641482 8:126826040-126826062 ATCTGATATAGAGAGTAGGAAGG + Intergenic
1048885611 8:138907022-138907044 CTCTTATCCACAGAGTAGCCGGG - Intronic
1049267116 8:141674091-141674113 CTCTGAGCCACAGAGTATGCCGG - Intergenic
1049769743 8:144374361-144374383 CTCTGCTAAACAGAGTCGGCCGG - Intronic
1049996092 9:1035406-1035428 CTCATAAACAAAAAGTAGGCAGG - Intergenic
1051509017 9:17856967-17856989 ATGTGAGACAAAGAGAAGGCAGG - Intergenic
1052113529 9:24619444-24619466 CACTGATACAGACAGGAGGCAGG - Intergenic
1052968281 9:34359557-34359579 CTGTGGTCCACAGAGTAGGCTGG - Intergenic
1053401983 9:37832916-37832938 CTCTGTTACCTAGACTAGGCTGG + Intronic
1055486220 9:76759264-76759286 CTCTGATACAAACAGGAAGCAGG + Intronic
1058318395 9:103598834-103598856 CTTTGATACAAACAGGAGGCAGG + Intergenic
1062711523 9:137977751-137977773 CTCTGGTACAAAGACTTGGAGGG - Intronic
1185794934 X:2956758-2956780 CCCTGTTTCAAAAAGTAGGCTGG - Intronic
1185821561 X:3209558-3209580 CTCTAGTACAAGGAGAAGGCAGG - Intergenic
1186558554 X:10586512-10586534 CTCTGATACCAGGAGTAAGGTGG + Intronic
1187823441 X:23312041-23312063 CCCTTATAGAAAGTGTAGGCAGG + Intergenic
1188288406 X:28358230-28358252 CTCTAATACAAAAATTAGCCAGG + Intergenic
1189109090 X:38268474-38268496 CTCTGCCACAAAGAATAGGAAGG - Intronic
1190307437 X:49093094-49093116 CTCTAATACAAAAATTAGCCAGG - Intronic
1190425888 X:50334299-50334321 CTCTGATACTAGGAGCAGGGTGG + Intronic
1190889971 X:54559246-54559268 ATTTGATACATAGACTAGGCAGG - Intronic
1191103765 X:56759785-56759807 CTCTGAAAGAAAGGGCAGGCAGG + Intergenic
1191793287 X:64993767-64993789 TTCTGAAATAAAGAGTTGGCAGG - Intronic
1192285147 X:69727415-69727437 CTTTGATCCAAACAGGAGGCAGG - Intronic
1196075039 X:111566957-111566979 CAATGATACAAAGAGCAGGAAGG + Intergenic
1196513852 X:116546629-116546651 GTCTGATACACAGAGTAGTGTGG - Intergenic