ID: 1082716205

View in Genome Browser
Species Human (GRCh38)
Location 11:56617323-56617345
Sequence GTCACAGGGTTTTGGTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082716199_1082716205 11 Left 1082716199 11:56617289-56617311 CCATGTGCAGCTTTGTTATAAAG No data
Right 1082716205 11:56617323-56617345 GTCACAGGGTTTTGGTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082716205 Original CRISPR GTCACAGGGTTTTGGTGTAC AGG Intergenic
No off target data available for this crispr