ID: 1082718673

View in Genome Browser
Species Human (GRCh38)
Location 11:56646561-56646583
Sequence CAGGGGAGACAGAAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082718673_1082718681 -1 Left 1082718673 11:56646561-56646583 CCATCCTTCTTCTGTCTCCCCTG No data
Right 1082718681 11:56646583-56646605 GGTAGCTGGAGGTTTGTCCTTGG No data
1082718673_1082718682 0 Left 1082718673 11:56646561-56646583 CCATCCTTCTTCTGTCTCCCCTG No data
Right 1082718682 11:56646584-56646606 GTAGCTGGAGGTTTGTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082718673 Original CRISPR CAGGGGAGACAGAAGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr