ID: 1082722678

View in Genome Browser
Species Human (GRCh38)
Location 11:56697446-56697468
Sequence TTAGGTTAGCAGTTGCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082722678_1082722681 -4 Left 1082722678 11:56697446-56697468 CCCAACAGCAACTGCTAACCTAA No data
Right 1082722681 11:56697465-56697487 CTAACATCAAGTATGAAAGAAGG No data
1082722678_1082722682 -1 Left 1082722678 11:56697446-56697468 CCCAACAGCAACTGCTAACCTAA No data
Right 1082722682 11:56697468-56697490 ACATCAAGTATGAAAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082722678 Original CRISPR TTAGGTTAGCAGTTGCTGTT GGG (reversed) Intergenic
No off target data available for this crispr