ID: 1082726229

View in Genome Browser
Species Human (GRCh38)
Location 11:56740253-56740275
Sequence CACCCAGGAACACCACAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082726229_1082726231 -5 Left 1082726229 11:56740253-56740275 CCTCTTTGTGGTGTTCCTGGGTG No data
Right 1082726231 11:56740271-56740293 GGGTGTGTACTGTCTGACTGTGG No data
1082726229_1082726232 -1 Left 1082726229 11:56740253-56740275 CCTCTTTGTGGTGTTCCTGGGTG No data
Right 1082726232 11:56740275-56740297 GTGTACTGTCTGACTGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082726229 Original CRISPR CACCCAGGAACACCACAAAG AGG (reversed) Intergenic
No off target data available for this crispr