ID: 1082726514

View in Genome Browser
Species Human (GRCh38)
Location 11:56743379-56743401
Sequence ATGGGTTACAAATTGCTGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082726503_1082726514 29 Left 1082726503 11:56743327-56743349 CCAGCAACAAGCCCAGTACAGAG 0: 1
1: 0
2: 0
3: 25
4: 219
Right 1082726514 11:56743379-56743401 ATGGGTTACAAATTGCTGCATGG 0: 1
1: 0
2: 2
3: 8
4: 143
1082726508_1082726514 18 Left 1082726508 11:56743338-56743360 CCCAGTACAGAGGGCGGTGGACA 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1082726514 11:56743379-56743401 ATGGGTTACAAATTGCTGCATGG 0: 1
1: 0
2: 2
3: 8
4: 143
1082726513_1082726514 -10 Left 1082726513 11:56743366-56743388 CCTGAATAAAGCAATGGGTTACA 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1082726514 11:56743379-56743401 ATGGGTTACAAATTGCTGCATGG 0: 1
1: 0
2: 2
3: 8
4: 143
1082726509_1082726514 17 Left 1082726509 11:56743339-56743361 CCAGTACAGAGGGCGGTGGACAT 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1082726514 11:56743379-56743401 ATGGGTTACAAATTGCTGCATGG 0: 1
1: 0
2: 2
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082726514 Original CRISPR ATGGGTTACAAATTGCTGCA TGG Exonic
904571128 1:31466029-31466051 AGGGATTCCAAATAGCTGCAGGG + Intergenic
905465318 1:38148803-38148825 ATGGGATACAAATATCTTCATGG - Intergenic
911109078 1:94164004-94164026 ATGGGATACAAATATCTTCACGG + Intronic
912384703 1:109265488-109265510 ATGGGTTACACATTGGCCCAGGG - Intronic
912695712 1:111840574-111840596 ATGACTTACAAATTTCTGAATGG - Intronic
913351942 1:117871275-117871297 AAGGGTAACAAATTAGTGCAAGG + Intronic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915350676 1:155223253-155223275 ATGGGATCAAAATTGCTGCTGGG - Intergenic
915469758 1:156118832-156118854 CTGGGTCAAAAATTGCTACAGGG - Intronic
918434456 1:184496954-184496976 ATAGGTTACAAATAGATGGAGGG + Intronic
918781136 1:188702072-188702094 ATGGGGTAGAACTTGCTGCTAGG - Intergenic
918958323 1:191238633-191238655 ATGGGATACAAATATCTTCATGG - Intergenic
919754069 1:201055676-201055698 ATTGGTTAGAACTTTCTGCAAGG - Intronic
919817951 1:201453587-201453609 ATGGGTCACAAATTAAAGCATGG + Intergenic
924782463 1:247164567-247164589 ATGAGTTACAAGATGCTGCTGGG + Intronic
1063028347 10:2205747-2205769 ATGTGTTTCTAATTGCTGTATGG - Intergenic
1064992199 10:21265991-21266013 ATTGGTTAAAAATTGCTTCTAGG + Intergenic
1065361786 10:24895813-24895835 ATGGGTTAAAAATTGCATCAAGG - Intronic
1067538051 10:47130932-47130954 AGTGGTTACAAATTGATGAATGG - Intergenic
1069762184 10:70818933-70818955 CTGGGTGATAAATTACTGCACGG - Intronic
1074134328 10:110613729-110613751 AGGGGTAACAATTTGCCGCAAGG + Intergenic
1074176054 10:111004399-111004421 ATTGGTTCCACATTTCTGCAAGG + Intronic
1075589895 10:123683901-123683923 AGAGGATACAAAGTGCTGCAGGG - Intronic
1076114816 10:127888023-127888045 AAGGGTTACATTTTCCTGCATGG - Intronic
1079679504 11:23276570-23276592 ATGGCTTGGAAATTGATGCAAGG + Intergenic
1081207970 11:40296585-40296607 AAGGGTTACAAATTCATGCCTGG - Intronic
1081967550 11:47178779-47178801 ATGGGTTGAAAATTGGTGCCAGG - Intronic
1082726514 11:56743379-56743401 ATGGGTTACAAATTGCTGCATGG + Exonic
1083584222 11:63845054-63845076 ATGGGCTTCAAAGTGCTGCTGGG - Intronic
1084846443 11:71904161-71904183 ATGGGTTAAAAAAGGCAGCAAGG + Intronic
1088265509 11:107984275-107984297 ATGGGATACAAATATCTTCATGG - Intergenic
1088782598 11:113150589-113150611 ATGAGTTACAAATTTCTTAATGG - Intronic
1090147308 11:124339295-124339317 GTGGGTTACAGATGGCTACATGG + Intergenic
1090452944 11:126822630-126822652 ATGGGTTAGAAATTCAGGCAGGG + Intronic
1092433485 12:8427598-8427620 ATGGGTTAAAAAAGGCAGCAAGG - Intergenic
1097767960 12:63547327-63547349 GTGGGTTAGAAATTCCAGCAGGG + Intergenic
1098200812 12:68053513-68053535 ATGGGCAAAAAATTGCTGTATGG - Intergenic
1098446590 12:70572220-70572242 TTAGGTTACAAATTTCTGGAGGG + Intronic
1101237481 12:102804203-102804225 AGGGGCTATAGATTGCTGCATGG + Intergenic
1102808349 12:115801948-115801970 ATTGGTTACACACTGCTTCAGGG + Intergenic
1103147517 12:118608496-118608518 ATGCTTTCCCAATTGCTGCAGGG + Intergenic
1106925349 13:34607617-34607639 ATGGGTTACACACTGCTGCATGG - Intergenic
1107686645 13:42907323-42907345 ATGTGGTAGTAATTGCTGCATGG + Intronic
1116242574 14:42364402-42364424 ATGGGGTACATATTTCAGCAAGG - Intergenic
1117426619 14:55605240-55605262 ATAGGTTAAAAATAGTTGCAAGG - Intronic
1118665895 14:68069199-68069221 ATGGTTTATAAATTGGAGCAAGG + Intronic
1118676944 14:68196409-68196431 ATGGCCTACAAAGTCCTGCATGG + Intronic
1122096264 14:99375090-99375112 ATGAGATACAAAGTGCTGGACGG - Intergenic
1122369122 14:101218521-101218543 ATGAATTACAAATAGATGCAGGG - Intergenic
1125661301 15:41397031-41397053 TTGGTTCACAAATTGCTGCGTGG - Exonic
1129452650 15:75659500-75659522 ATGGGTTAGAAAATGGGGCAGGG - Exonic
1130004936 15:80086482-80086504 ATTGTTTACAAATTGGTTCAAGG - Intronic
1130356609 15:83137853-83137875 ATGGGATACAAATCAATGCATGG + Exonic
1134544851 16:15100167-15100189 ATGGTTTGCAAATGGCTGAATGG + Intronic
1135362481 16:21826884-21826906 ATGGTTTGCAAATGGCTGAATGG + Intergenic
1135634441 16:24062122-24062144 CTGTGTAACAAATTGCTGCAAGG + Intronic
1136740656 16:32520993-32521015 AGTGTTTACAAACTGCTGCATGG + Intergenic
1137321425 16:47387065-47387087 TTGGGTCATAAATTGCTCCATGG - Intronic
1139162550 16:64528577-64528599 ATGGGTTAGGAATTGAGGCAGGG - Intergenic
1139612827 16:68071024-68071046 ATGGGTTCCACATGGCTGCTCGG - Exonic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140234781 16:73148427-73148449 ATAGTTTTCAAATTGCTGCATGG - Intergenic
1203028947 16_KI270728v1_random:554241-554263 AGTGTTTACAAACTGCTGCATGG - Intergenic
1203042774 16_KI270728v1_random:780190-780212 AGTGTTTACAAACTGCTGCATGG + Intergenic
1154930448 18:20989588-20989610 AAGGATGACAGATTGCTGCATGG + Intronic
1158304283 18:56087524-56087546 ATTAGGTACAAATTGTTGCAAGG - Intergenic
1158768927 18:60491215-60491237 ATATGTTTCAAAATGCTGCAAGG + Intergenic
1159310452 18:66700994-66701016 ATTGGCTATCAATTGCTGCAAGG + Intergenic
1160286013 18:77544147-77544169 ATGGGTTTTAGATTGCTGCTGGG + Intergenic
1163362173 19:16853509-16853531 ATGGGCTGTGAATTGCTGCATGG + Intronic
1163362182 19:16853640-16853662 ATGGGCTGTGAATTGCTGCATGG + Intronic
1163362200 19:16853862-16853884 ATGGGCTGTGAATTGCTGCATGG + Intronic
1168438590 19:56343391-56343413 TTGGTTCACAAATTGCTGCATGG - Intronic
926958524 2:18329112-18329134 ATGACTTACAAGTTGCTGTAAGG + Intronic
928579196 2:32689178-32689200 ATTGATTACAAAATGTTGCAAGG + Intronic
933459727 2:82566863-82566885 CTTGGTTACAGATAGCTGCAAGG + Intergenic
933554267 2:83812007-83812029 TTGGTTCACAAATTGCTGCTTGG - Intergenic
936372483 2:111913963-111913985 ATTGGTTACAACTTTCAGCACGG + Intronic
941420245 2:165275388-165275410 ATGTGGTACAAATTGCTCCAGGG - Intronic
944364811 2:198905687-198905709 ATGGGTCTCAAATTGGTGGAGGG - Intergenic
946671158 2:222105880-222105902 AAGGGTTACAACTGGCTGGAGGG - Intergenic
947467250 2:230362174-230362196 ATGGGGTACACAATTCTGCAGGG - Intronic
1168746482 20:247143-247165 ATGAGTTACAAATTGAGGCTGGG + Intergenic
1170234166 20:14083501-14083523 GTGGTTTACAAACTGATGCATGG + Intronic
1175857175 20:62128022-62128044 ATGTGTTCCAGAGTGCTGCAGGG + Intronic
1177913264 21:27056883-27056905 ATGGGATACAAATATCTTCATGG - Intergenic
1178005959 21:28219760-28219782 ATGGGATACAAATATCTTCATGG + Intergenic
1178443999 21:32622075-32622097 ATGGGTTAAAAAAGGCAGCAAGG + Intergenic
1178691635 21:34754877-34754899 ATGGTTTCCCACTTGCTGCAGGG + Intergenic
1185010576 22:48310695-48310717 AAGGCTTACGAAGTGCTGCAGGG + Intergenic
1185121898 22:48976498-48976520 ATGAGTTAGAAGCTGCTGCAGGG + Intergenic
951162607 3:19443287-19443309 ATGGGTGAAAAAATGCTGAATGG + Intronic
952142099 3:30491427-30491449 AGGATTTTCAAATTGCTGCATGG - Intergenic
955868816 3:63415802-63415824 CTGTGTTGCAATTTGCTGCAGGG - Intronic
956393797 3:68803296-68803318 ATGGGTTTGAAACTGCTGCCTGG + Intronic
956616574 3:71178428-71178450 ATGGGTTAGAAATTACTGGCCGG - Intronic
957882496 3:86238085-86238107 AGGGGCAACAAATTGCGGCAAGG + Intergenic
957986253 3:87575542-87575564 AGGGGTTACAAAGTGCTCAATGG - Intergenic
958559910 3:95734231-95734253 ATGGGTTACAATTTGATATATGG + Intergenic
961432798 3:126895007-126895029 ATGCATTACAAATTTCTGAAAGG - Intronic
964206112 3:154177105-154177127 ATGGTTTACAAATTACTGATTGG + Intronic
965111695 3:164432772-164432794 ATGGGTTACAGTTTCCTGCTGGG + Intergenic
968862721 4:3185284-3185306 ATGGGTTAGGATTGGCTGCATGG + Intronic
970591940 4:17567374-17567396 TTTGGTTACAGATTGCTACATGG + Intergenic
972806007 4:42530001-42530023 ATGGGATACAAATATCTTCACGG - Intronic
975982516 4:80176606-80176628 ATGGGATACAAATATCTTCATGG + Intergenic
976730971 4:88260899-88260921 ATAGGTTAAAAATTGCTATATGG - Exonic
976876940 4:89864657-89864679 ATTTTTTAAAAATTGCTGCAGGG - Intergenic
977186095 4:93938727-93938749 ATGCCTAAAAAATTGCTGCAGGG + Intergenic
978297567 4:107224616-107224638 ATGGGTTATAAATATCTCCATGG - Intronic
978404021 4:108361131-108361153 CTGAGTTACAAATTGCTGTCAGG + Intergenic
980870986 4:138610456-138610478 ATTGGTTACACATTGCCTCAGGG + Intergenic
986737275 5:10677252-10677274 ATCGTTTACAAATTTTTGCATGG + Intergenic
988027510 5:25716333-25716355 ATGGCTTAGAAATTGCTTCTAGG + Intergenic
988188871 5:27901915-27901937 ATGGGATACAAATATCTTCATGG - Intergenic
988478373 5:31608399-31608421 ATGAGTGAGAAATAGCTGCAGGG + Intergenic
989280556 5:39637803-39637825 ATAGATTACAAATTGCTTGAGGG + Intergenic
989564977 5:42893022-42893044 CTGGGTTAAAATTTGCTTCAGGG + Intergenic
991946230 5:71900798-71900820 ATGGGATACAAATATCAGCATGG - Intergenic
993151733 5:84171468-84171490 ATGGGCTAAAAGTTGTTGCAGGG + Intronic
996164873 5:120211843-120211865 ATGGGATACAAATATCTTCATGG + Intergenic
1000258300 5:159561496-159561518 ATAGGTAACAAATTGCTGAAGGG + Intergenic
1001358227 5:171053688-171053710 ATGGCTTACAAATTGCAGAGTGG - Intronic
1004551693 6:16654135-16654157 ATGGGTTGCACATGGCTTCAAGG - Intronic
1008967175 6:57324321-57324343 ATGGGTTATAAATTGGTGTGTGG + Intronic
1013418235 6:109943707-109943729 TGGGTTTACAAAGTGCTGCAGGG + Intergenic
1017107498 6:150901522-150901544 ATGGGTTACATTATGCTCCACGG - Intronic
1017269515 6:152490537-152490559 AGGGGTTACAAGGTGCTGAATGG - Intronic
1022983971 7:35630971-35630993 ATGGCTTACAAAATCCTGAAAGG - Intergenic
1025606362 7:63042720-63042742 ATGGGTTGCAAACAGATGCAGGG + Intergenic
1027255746 7:76429707-76429729 ATGGGCTACAGCTTGCAGCATGG + Intronic
1028047039 7:86133795-86133817 AAGAGTTACAAATTTATGCAGGG - Intergenic
1028213252 7:88101197-88101219 ATGTGTTACAATATGCTGCCAGG + Intronic
1028585201 7:92445700-92445722 ATGGGTTACAAATTTTTGTAAGG + Intergenic
1029882664 7:103832895-103832917 ACGGGTTACAAAATGCTATAAGG - Intronic
1032660488 7:133978582-133978604 ATGTTTTAGAAATTGCTGAAAGG + Intronic
1038352795 8:26795307-26795329 AAGGATTAAAAATCGCTGCAAGG + Intronic
1040118909 8:43658738-43658760 ATGGGCTACAAATTGTTCCCTGG - Intergenic
1048688150 8:136927598-136927620 CTGGGTTGCAAATTGCAGCTAGG - Intergenic
1050494115 9:6221700-6221722 AGAGGTTACTAGTTGCTGCATGG - Intronic
1050702889 9:8360930-8360952 ATGGATTATTAATTGATGCAGGG - Intronic
1051040001 9:12797058-12797080 ATGGGTTAAAAATTTCTGCATGG + Intronic
1051705512 9:19875502-19875524 ATGTGTTACCAAGTCCTGCAAGG + Intergenic
1056249512 9:84733481-84733503 AAGTGTTACAACTCGCTGCAAGG - Intronic
1056883941 9:90421702-90421724 ATGGGTCTCAAAGTGCAGCAGGG + Intergenic
1057533923 9:95879448-95879470 ATGTGTTAAGAATTGCTGTAAGG + Intronic
1186477810 X:9872084-9872106 TTGGTTTACATATTGCTACAGGG - Intronic
1187888248 X:23908830-23908852 TTGGGTTTCTCATTGCTGCAAGG + Intronic
1188582847 X:31736207-31736229 ATGCGTTTCAAATTTCTGGAAGG + Intronic
1188963338 X:36520205-36520227 TTTGGTTTAAAATTGCTGCACGG - Intergenic
1191797564 X:65036813-65036835 ATTGGATTCAAATTACTGCAGGG - Intergenic
1194386617 X:93263321-93263343 ATGGCCTACAAATTTCTGCTAGG - Intergenic
1194713145 X:97259471-97259493 GTGGGTTATAAATTGCTGAAAGG + Intronic
1197274594 X:124463520-124463542 AAGGGTTACATAATGCTCCATGG - Intronic