ID: 1082731024

View in Genome Browser
Species Human (GRCh38)
Location 11:56797879-56797901
Sequence GTGCAGTCACAGGTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082731024_1082731030 1 Left 1082731024 11:56797879-56797901 CCCTCCTCAACCTGTGACTGCAC No data
Right 1082731030 11:56797903-56797925 AAGAAGAGGTCAGACTTTCTGGG No data
1082731024_1082731029 0 Left 1082731024 11:56797879-56797901 CCCTCCTCAACCTGTGACTGCAC No data
Right 1082731029 11:56797902-56797924 AAAGAAGAGGTCAGACTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082731024 Original CRISPR GTGCAGTCACAGGTTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr