ID: 1082733210

View in Genome Browser
Species Human (GRCh38)
Location 11:56825368-56825390
Sequence CAATGAAGTCCAGGCTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5964
Summary {0: 18, 1: 595, 2: 1583, 3: 2091, 4: 1677}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082733210_1082733214 27 Left 1082733210 11:56825368-56825390 CCTCATCAGCCTGGACTTCATTG 0: 18
1: 595
2: 1583
3: 2091
4: 1677
Right 1082733214 11:56825418-56825440 CAACCATTTTATGAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082733210 Original CRISPR CAATGAAGTCCAGGCTGATG AGG (reversed) Intergenic
Too many off-targets to display for this crispr