ID: 1082733212 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:56825391-56825413 |
Sequence | CAAAATGCTGATAGTAATAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1082733212_1082733214 | 4 | Left | 1082733212 | 11:56825391-56825413 | CCCATATTACTATCAGCATTTTG | No data | ||
Right | 1082733214 | 11:56825418-56825440 | CAACCATTTTATGAGTCTCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1082733212 | Original CRISPR | CAAAATGCTGATAGTAATAT GGG (reversed) | Intergenic | ||