ID: 1082733212

View in Genome Browser
Species Human (GRCh38)
Location 11:56825391-56825413
Sequence CAAAATGCTGATAGTAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082733212_1082733214 4 Left 1082733212 11:56825391-56825413 CCCATATTACTATCAGCATTTTG No data
Right 1082733214 11:56825418-56825440 CAACCATTTTATGAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082733212 Original CRISPR CAAAATGCTGATAGTAATAT GGG (reversed) Intergenic
No off target data available for this crispr