ID: 1082733214

View in Genome Browser
Species Human (GRCh38)
Location 11:56825418-56825440
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082733210_1082733214 27 Left 1082733210 11:56825368-56825390 CCTCATCAGCCTGGACTTCATTG No data
Right 1082733214 11:56825418-56825440 CAACCATTTTATGAGTCTCTAGG No data
1082733212_1082733214 4 Left 1082733212 11:56825391-56825413 CCCATATTACTATCAGCATTTTG No data
Right 1082733214 11:56825418-56825440 CAACCATTTTATGAGTCTCTAGG No data
1082733211_1082733214 18 Left 1082733211 11:56825377-56825399 CCTGGACTTCATTGCCCATATTA No data
Right 1082733214 11:56825418-56825440 CAACCATTTTATGAGTCTCTAGG No data
1082733213_1082733214 3 Left 1082733213 11:56825392-56825414 CCATATTACTATCAGCATTTTGA No data
Right 1082733214 11:56825418-56825440 CAACCATTTTATGAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082733214 Original CRISPR CAACCATTTTATGAGTCTCT AGG Intergenic