ID: 1082734257

View in Genome Browser
Species Human (GRCh38)
Location 11:56838798-56838820
Sequence CTCTGTTAGGGCAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082734257_1082734261 -10 Left 1082734257 11:56838798-56838820 CCTTCCACATTGCCCTAACAGAG No data
Right 1082734261 11:56838811-56838833 CCTAACAGAGCTTCTCCATGAGG No data
1082734257_1082734262 -9 Left 1082734257 11:56838798-56838820 CCTTCCACATTGCCCTAACAGAG No data
Right 1082734262 11:56838812-56838834 CTAACAGAGCTTCTCCATGAGGG No data
1082734257_1082734266 29 Left 1082734257 11:56838798-56838820 CCTTCCACATTGCCCTAACAGAG No data
Right 1082734266 11:56838850-56838872 AAACATCTATCTGGACATCCAGG No data
1082734257_1082734265 20 Left 1082734257 11:56838798-56838820 CCTTCCACATTGCCCTAACAGAG No data
Right 1082734265 11:56838841-56838863 CCTTACAGCAAACATCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082734257 Original CRISPR CTCTGTTAGGGCAATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr