ID: 1082735360

View in Genome Browser
Species Human (GRCh38)
Location 11:56849250-56849272
Sequence ACAAAAATATCTGATAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082735360_1082735362 12 Left 1082735360 11:56849250-56849272 CCTGATTTATCAGATATTTTTGT No data
Right 1082735362 11:56849285-56849307 CCTGAACTGAAAAGCCAAAGTGG No data
1082735360_1082735365 28 Left 1082735360 11:56849250-56849272 CCTGATTTATCAGATATTTTTGT No data
Right 1082735365 11:56849301-56849323 AAAGTGGCCCATTGCAGAGGAGG No data
1082735360_1082735363 25 Left 1082735360 11:56849250-56849272 CCTGATTTATCAGATATTTTTGT No data
Right 1082735363 11:56849298-56849320 GCCAAAGTGGCCCATTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082735360 Original CRISPR ACAAAAATATCTGATAAATC AGG (reversed) Intergenic
No off target data available for this crispr