ID: 1082735365

View in Genome Browser
Species Human (GRCh38)
Location 11:56849301-56849323
Sequence AAAGTGGCCCATTGCAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082735361_1082735365 -7 Left 1082735361 11:56849285-56849307 CCTGAACTGAAAAGCCAAAGTGG No data
Right 1082735365 11:56849301-56849323 AAAGTGGCCCATTGCAGAGGAGG No data
1082735360_1082735365 28 Left 1082735360 11:56849250-56849272 CCTGATTTATCAGATATTTTTGT No data
Right 1082735365 11:56849301-56849323 AAAGTGGCCCATTGCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082735365 Original CRISPR AAAGTGGCCCATTGCAGAGG AGG Intergenic
No off target data available for this crispr