ID: 1082753912

View in Genome Browser
Species Human (GRCh38)
Location 11:57052927-57052949
Sequence CTTGAGATTCCTGAATTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082753912_1082753915 1 Left 1082753912 11:57052927-57052949 CCCACCAATTCAGGAATCTCAAG No data
Right 1082753915 11:57052951-57052973 AGCCCCAAGCACAAGTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082753912 Original CRISPR CTTGAGATTCCTGAATTGGT GGG (reversed) Intergenic
No off target data available for this crispr