ID: 1082754110

View in Genome Browser
Species Human (GRCh38)
Location 11:57055646-57055668
Sequence TATTATTTACAGAAAGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082754110_1082754113 13 Left 1082754110 11:57055646-57055668 CCCCACACTTTCTGTAAATAATA No data
Right 1082754113 11:57055682-57055704 AATAATAAATAATAATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082754110 Original CRISPR TATTATTTACAGAAAGTGTG GGG (reversed) Intergenic
No off target data available for this crispr