ID: 1082755945

View in Genome Browser
Species Human (GRCh38)
Location 11:57076541-57076563
Sequence GTGTATACACACATATATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082755942_1082755945 11 Left 1082755942 11:57076507-57076529 CCCAATGTATATATATATGTGTG No data
Right 1082755945 11:57076541-57076563 GTGTATACACACATATATGTGGG No data
1082755943_1082755945 10 Left 1082755943 11:57076508-57076530 CCAATGTATATATATATGTGTGT No data
Right 1082755945 11:57076541-57076563 GTGTATACACACATATATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082755945 Original CRISPR GTGTATACACACATATATGT GGG Intergenic
No off target data available for this crispr