ID: 1082756599

View in Genome Browser
Species Human (GRCh38)
Location 11:57082974-57082996
Sequence TTTGGGGCGATTCCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082756599_1082756606 5 Left 1082756599 11:57082974-57082996 CCAGCAGCTGGAATCGCCCCAAA No data
Right 1082756606 11:57083002-57083024 CAGCAGGGGAATTTCCACAAAGG No data
1082756599_1082756602 -9 Left 1082756599 11:57082974-57082996 CCAGCAGCTGGAATCGCCCCAAA No data
Right 1082756602 11:57082988-57083010 CGCCCCAAAAGCAGCAGCAGGGG No data
1082756599_1082756601 -10 Left 1082756599 11:57082974-57082996 CCAGCAGCTGGAATCGCCCCAAA No data
Right 1082756601 11:57082987-57083009 TCGCCCCAAAAGCAGCAGCAGGG No data
1082756599_1082756608 30 Left 1082756599 11:57082974-57082996 CCAGCAGCTGGAATCGCCCCAAA No data
Right 1082756608 11:57083027-57083049 TTCCCCAAATTGTCCTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082756599 Original CRISPR TTTGGGGCGATTCCAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr