ID: 1082757916

View in Genome Browser
Species Human (GRCh38)
Location 11:57096455-57096477
Sequence AAGAAAAAAGAGAAGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082757916_1082757920 0 Left 1082757916 11:57096455-57096477 CCAGACCCCTTCTCTTTTTTCTT No data
Right 1082757920 11:57096478-57096500 TTTTTTTTTTCTTTTAAAGACGG No data
1082757916_1082757921 24 Left 1082757916 11:57096455-57096477 CCAGACCCCTTCTCTTTTTTCTT No data
Right 1082757921 11:57096502-57096524 GTCTCACTCTGTTGCCAGACTGG 0: 62
1: 1580
2: 4622
3: 9747
4: 12440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082757916 Original CRISPR AAGAAAAAAGAGAAGGGGTC TGG (reversed) Intergenic
No off target data available for this crispr