ID: 1082757920

View in Genome Browser
Species Human (GRCh38)
Location 11:57096478-57096500
Sequence TTTTTTTTTTCTTTTAAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082757919_1082757920 -7 Left 1082757919 11:57096462-57096484 CCTTCTCTTTTTTCTTTTTTTTT 0: 7
1: 520
2: 7180
3: 47311
4: 83418
Right 1082757920 11:57096478-57096500 TTTTTTTTTTCTTTTAAAGACGG No data
1082757917_1082757920 -5 Left 1082757917 11:57096460-57096482 CCCCTTCTCTTTTTTCTTTTTTT No data
Right 1082757920 11:57096478-57096500 TTTTTTTTTTCTTTTAAAGACGG No data
1082757918_1082757920 -6 Left 1082757918 11:57096461-57096483 CCCTTCTCTTTTTTCTTTTTTTT No data
Right 1082757920 11:57096478-57096500 TTTTTTTTTTCTTTTAAAGACGG No data
1082757915_1082757920 10 Left 1082757915 11:57096445-57096467 CCTGTGAGATCCAGACCCCTTCT No data
Right 1082757920 11:57096478-57096500 TTTTTTTTTTCTTTTAAAGACGG No data
1082757916_1082757920 0 Left 1082757916 11:57096455-57096477 CCAGACCCCTTCTCTTTTTTCTT No data
Right 1082757920 11:57096478-57096500 TTTTTTTTTTCTTTTAAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082757920 Original CRISPR TTTTTTTTTTCTTTTAAAGA CGG Intergenic
No off target data available for this crispr