ID: 1082757921

View in Genome Browser
Species Human (GRCh38)
Location 11:57096502-57096524
Sequence GTCTCACTCTGTTGCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28451
Summary {0: 62, 1: 1580, 2: 4622, 3: 9747, 4: 12440}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082757918_1082757921 18 Left 1082757918 11:57096461-57096483 CCCTTCTCTTTTTTCTTTTTTTT No data
Right 1082757921 11:57096502-57096524 GTCTCACTCTGTTGCCAGACTGG 0: 62
1: 1580
2: 4622
3: 9747
4: 12440
1082757917_1082757921 19 Left 1082757917 11:57096460-57096482 CCCCTTCTCTTTTTTCTTTTTTT No data
Right 1082757921 11:57096502-57096524 GTCTCACTCTGTTGCCAGACTGG 0: 62
1: 1580
2: 4622
3: 9747
4: 12440
1082757916_1082757921 24 Left 1082757916 11:57096455-57096477 CCAGACCCCTTCTCTTTTTTCTT No data
Right 1082757921 11:57096502-57096524 GTCTCACTCTGTTGCCAGACTGG 0: 62
1: 1580
2: 4622
3: 9747
4: 12440
1082757919_1082757921 17 Left 1082757919 11:57096462-57096484 CCTTCTCTTTTTTCTTTTTTTTT 0: 7
1: 520
2: 7180
3: 47311
4: 83418
Right 1082757921 11:57096502-57096524 GTCTCACTCTGTTGCCAGACTGG 0: 62
1: 1580
2: 4622
3: 9747
4: 12440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082757921 Original CRISPR GTCTCACTCTGTTGCCAGAC TGG Intergenic
Too many off-targets to display for this crispr