ID: 1082758037

View in Genome Browser
Species Human (GRCh38)
Location 11:57097300-57097322
Sequence AGTCAGTCCCAGGACTGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082758037_1082758040 -10 Left 1082758037 11:57097300-57097322 CCGCAACAGTCCTGGGACTGACT No data
Right 1082758040 11:57097313-57097335 GGGACTGACTCTCATTGGCCTGG No data
1082758037_1082758042 25 Left 1082758037 11:57097300-57097322 CCGCAACAGTCCTGGGACTGACT No data
Right 1082758042 11:57097348-57097370 GCCCATCCCTGAACCAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082758037 Original CRISPR AGTCAGTCCCAGGACTGTTG CGG (reversed) Intergenic
No off target data available for this crispr